ID: 1181550939

View in Genome Browser
Species Human (GRCh38)
Location 22:23638865-23638887
Sequence CCAGTGTGGCCTTGTTGGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181550934_1181550939 4 Left 1181550934 22:23638838-23638860 CCCGGATAAAGTTATTCATGAGA 0: 1
1: 0
2: 3
3: 7
4: 149
Right 1181550939 22:23638865-23638887 CCAGTGTGGCCTTGTTGGCTTGG No data
1181550933_1181550939 15 Left 1181550933 22:23638827-23638849 CCATCAAGATTCCCGGATAAAGT 0: 1
1: 0
2: 1
3: 3
4: 64
Right 1181550939 22:23638865-23638887 CCAGTGTGGCCTTGTTGGCTTGG No data
1181550935_1181550939 3 Left 1181550935 22:23638839-23638861 CCGGATAAAGTTATTCATGAGAC 0: 1
1: 0
2: 1
3: 15
4: 148
Right 1181550939 22:23638865-23638887 CCAGTGTGGCCTTGTTGGCTTGG No data
1181550931_1181550939 23 Left 1181550931 22:23638819-23638841 CCAGGTCACCATCAAGATTCCCG 0: 1
1: 1
2: 1
3: 3
4: 57
Right 1181550939 22:23638865-23638887 CCAGTGTGGCCTTGTTGGCTTGG No data
1181550930_1181550939 27 Left 1181550930 22:23638815-23638837 CCTTCCAGGTCACCATCAAGATT 0: 1
1: 2
2: 0
3: 16
4: 141
Right 1181550939 22:23638865-23638887 CCAGTGTGGCCTTGTTGGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181550939 Original CRISPR CCAGTGTGGCCTTGTTGGCT TGG Intergenic