ID: 1181552711

View in Genome Browser
Species Human (GRCh38)
Location 22:23649837-23649859
Sequence GATTTGTCCTGGGAGATCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181552711_1181552721 24 Left 1181552711 22:23649837-23649859 CCAGTGATCTCCCAGGACAAATC No data
Right 1181552721 22:23649884-23649906 AAGTGGGGCCATGTGAACCAAGG No data
1181552711_1181552720 9 Left 1181552711 22:23649837-23649859 CCAGTGATCTCCCAGGACAAATC No data
Right 1181552720 22:23649869-23649891 GGAAAAAGAGGATGGAAGTGGGG No data
1181552711_1181552718 7 Left 1181552711 22:23649837-23649859 CCAGTGATCTCCCAGGACAAATC No data
Right 1181552718 22:23649867-23649889 AGGGAAAAAGAGGATGGAAGTGG No data
1181552711_1181552719 8 Left 1181552711 22:23649837-23649859 CCAGTGATCTCCCAGGACAAATC No data
Right 1181552719 22:23649868-23649890 GGGAAAAAGAGGATGGAAGTGGG No data
1181552711_1181552716 -3 Left 1181552711 22:23649837-23649859 CCAGTGATCTCCCAGGACAAATC No data
Right 1181552716 22:23649857-23649879 ATCAGTCTTAAGGGAAAAAGAGG No data
1181552711_1181552722 30 Left 1181552711 22:23649837-23649859 CCAGTGATCTCCCAGGACAAATC No data
Right 1181552722 22:23649890-23649912 GGCCATGTGAACCAAGGACTAGG No data
1181552711_1181552717 1 Left 1181552711 22:23649837-23649859 CCAGTGATCTCCCAGGACAAATC No data
Right 1181552717 22:23649861-23649883 GTCTTAAGGGAAAAAGAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181552711 Original CRISPR GATTTGTCCTGGGAGATCAC TGG (reversed) Intergenic
No off target data available for this crispr