ID: 1181553012

View in Genome Browser
Species Human (GRCh38)
Location 22:23651796-23651818
Sequence GGCCAATATGAGGCAGCCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181553005_1181553012 7 Left 1181553005 22:23651766-23651788 CCAAAGACACCAGGTGAAAGCCT No data
Right 1181553012 22:23651796-23651818 GGCCAATATGAGGCAGCCTTTGG No data
1181553008_1181553012 -2 Left 1181553008 22:23651775-23651797 CCAGGTGAAAGCCTGGGATGAGG No data
Right 1181553012 22:23651796-23651818 GGCCAATATGAGGCAGCCTTTGG No data
1181553003_1181553012 13 Left 1181553003 22:23651760-23651782 CCAGTCCCAAAGACACCAGGTGA No data
Right 1181553012 22:23651796-23651818 GGCCAATATGAGGCAGCCTTTGG No data
1181553004_1181553012 8 Left 1181553004 22:23651765-23651787 CCCAAAGACACCAGGTGAAAGCC No data
Right 1181553012 22:23651796-23651818 GGCCAATATGAGGCAGCCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181553012 Original CRISPR GGCCAATATGAGGCAGCCTT TGG Intergenic
No off target data available for this crispr