ID: 1181553100

View in Genome Browser
Species Human (GRCh38)
Location 22:23652310-23652332
Sequence TGCAGGAAATGCCCCACTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181553094_1181553100 13 Left 1181553094 22:23652274-23652296 CCAGCTGAGCTAGACTGCCATGG No data
Right 1181553100 22:23652310-23652332 TGCAGGAAATGCCCCACTCCTGG No data
1181553097_1181553100 -4 Left 1181553097 22:23652291-23652313 CCATGGGAATATTGCCGTCTGCA No data
Right 1181553100 22:23652310-23652332 TGCAGGAAATGCCCCACTCCTGG No data
1181553093_1181553100 18 Left 1181553093 22:23652269-23652291 CCTTGCCAGCTGAGCTAGACTGC No data
Right 1181553100 22:23652310-23652332 TGCAGGAAATGCCCCACTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181553100 Original CRISPR TGCAGGAAATGCCCCACTCC TGG Intergenic
No off target data available for this crispr