ID: 1181553418

View in Genome Browser
Species Human (GRCh38)
Location 22:23653843-23653865
Sequence CACCCCAAGGAGATGGTGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181553412_1181553418 -9 Left 1181553412 22:23653829-23653851 CCACCACATGGCACCACCCCAAG No data
Right 1181553418 22:23653843-23653865 CACCCCAAGGAGATGGTGGCAGG No data
1181553411_1181553418 -8 Left 1181553411 22:23653828-23653850 CCCACCACATGGCACCACCCCAA No data
Right 1181553418 22:23653843-23653865 CACCCCAAGGAGATGGTGGCAGG No data
1181553409_1181553418 11 Left 1181553409 22:23653809-23653831 CCTTGAAGTTGGGGTCTTTCCCA No data
Right 1181553418 22:23653843-23653865 CACCCCAAGGAGATGGTGGCAGG No data
1181553405_1181553418 24 Left 1181553405 22:23653796-23653818 CCACTGCGTCTGGCCTTGAAGTT No data
Right 1181553418 22:23653843-23653865 CACCCCAAGGAGATGGTGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181553418 Original CRISPR CACCCCAAGGAGATGGTGGC AGG Intergenic
No off target data available for this crispr