ID: 1181554699

View in Genome Browser
Species Human (GRCh38)
Location 22:23662067-23662089
Sequence AGTTATCTGGGCATGATGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181554691_1181554699 19 Left 1181554691 22:23662025-23662047 CCTGACTAACATGGTGAAACCCC 0: 941
1: 32260
2: 151536
3: 200403
4: 153855
Right 1181554699 22:23662067-23662089 AGTTATCTGGGCATGATGGCGGG No data
1181554693_1181554699 -1 Left 1181554693 22:23662045-23662067 CCCATCTCTACAAAAATACAAAA 0: 1018
1: 5655
2: 12450
3: 21001
4: 54238
Right 1181554699 22:23662067-23662089 AGTTATCTGGGCATGATGGCGGG No data
1181554690_1181554699 23 Left 1181554690 22:23662021-23662043 CCAGCCTGACTAACATGGTGAAA 0: 942
1: 25011
2: 158570
3: 221973
4: 157809
Right 1181554699 22:23662067-23662089 AGTTATCTGGGCATGATGGCGGG No data
1181554694_1181554699 -2 Left 1181554694 22:23662046-23662068 CCATCTCTACAAAAATACAAAAG 0: 39
1: 1893
2: 8140
3: 9866
4: 32194
Right 1181554699 22:23662067-23662089 AGTTATCTGGGCATGATGGCGGG No data
1181554692_1181554699 0 Left 1181554692 22:23662044-23662066 CCCCATCTCTACAAAAATACAAA 0: 972
1: 4940
2: 10477
3: 21211
4: 49033
Right 1181554699 22:23662067-23662089 AGTTATCTGGGCATGATGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181554699 Original CRISPR AGTTATCTGGGCATGATGGC GGG Intergenic
No off target data available for this crispr