ID: 1181555500

View in Genome Browser
Species Human (GRCh38)
Location 22:23669326-23669348
Sequence CTGTAATCCCAGCTGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181555496_1181555500 -3 Left 1181555496 22:23669306-23669328 CCAAGCATGGTGGTGGGCGCCTG 0: 81
1: 2828
2: 16857
3: 48836
4: 86814
Right 1181555500 22:23669326-23669348 CTGTAATCCCAGCTGGTGGAAGG No data
1181555490_1181555500 30 Left 1181555490 22:23669273-23669295 CCTGGCTTTACTAATAATACCAA No data
Right 1181555500 22:23669326-23669348 CTGTAATCCCAGCTGGTGGAAGG No data
1181555491_1181555500 11 Left 1181555491 22:23669292-23669314 CCAAAACAATTTAGCCAAGCATG No data
Right 1181555500 22:23669326-23669348 CTGTAATCCCAGCTGGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181555500 Original CRISPR CTGTAATCCCAGCTGGTGGA AGG Intergenic
No off target data available for this crispr