ID: 1181555661

View in Genome Browser
Species Human (GRCh38)
Location 22:23670434-23670456
Sequence CAGTTTCCCCACATGTAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181555661_1181555669 28 Left 1181555661 22:23670434-23670456 CCTGCTTACATGTGGGGAAACTG No data
Right 1181555669 22:23670485-23670507 GGTCCACTTGCCCGGTTTCCAGG No data
1181555661_1181555665 -4 Left 1181555661 22:23670434-23670456 CCTGCTTACATGTGGGGAAACTG No data
Right 1181555665 22:23670453-23670475 ACTGAGTCTCAGAGGGGCTAAGG No data
1181555661_1181555664 -10 Left 1181555661 22:23670434-23670456 CCTGCTTACATGTGGGGAAACTG No data
Right 1181555664 22:23670447-23670469 GGGGAAACTGAGTCTCAGAGGGG No data
1181555661_1181555670 29 Left 1181555661 22:23670434-23670456 CCTGCTTACATGTGGGGAAACTG No data
Right 1181555670 22:23670486-23670508 GTCCACTTGCCCGGTTTCCAGGG No data
1181555661_1181555666 7 Left 1181555661 22:23670434-23670456 CCTGCTTACATGTGGGGAAACTG No data
Right 1181555666 22:23670464-23670486 GAGGGGCTAAGGTATTGCCGAGG No data
1181555661_1181555667 20 Left 1181555661 22:23670434-23670456 CCTGCTTACATGTGGGGAAACTG No data
Right 1181555667 22:23670477-23670499 ATTGCCGAGGTCCACTTGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181555661 Original CRISPR CAGTTTCCCCACATGTAAGC AGG (reversed) Intergenic