ID: 1181555669

View in Genome Browser
Species Human (GRCh38)
Location 22:23670485-23670507
Sequence GGTCCACTTGCCCGGTTTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181555661_1181555669 28 Left 1181555661 22:23670434-23670456 CCTGCTTACATGTGGGGAAACTG No data
Right 1181555669 22:23670485-23670507 GGTCCACTTGCCCGGTTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181555669 Original CRISPR GGTCCACTTGCCCGGTTTCC AGG Intergenic