ID: 1181555881

View in Genome Browser
Species Human (GRCh38)
Location 22:23671475-23671497
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 4, 1: 0, 2: 0, 3: 6, 4: 128}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181555881_1181555899 27 Left 1181555881 22:23671475-23671497 CCATCCAGAAACATTAGCACCCC 0: 4
1: 0
2: 0
3: 6
4: 128
Right 1181555899 22:23671525-23671547 AGAAAGGCAGGGCCCAGAGAGGG 0: 4
1: 1
2: 17
3: 116
4: 788
1181555881_1181555890 11 Left 1181555881 22:23671475-23671497 CCATCCAGAAACATTAGCACCCC 0: 4
1: 0
2: 0
3: 6
4: 128
Right 1181555890 22:23671509-23671531 ACCACCCGAACAGCCCAGAAAGG 0: 2
1: 2
2: 0
3: 5
4: 91
1181555881_1181555893 15 Left 1181555881 22:23671475-23671497 CCATCCAGAAACATTAGCACCCC 0: 4
1: 0
2: 0
3: 6
4: 128
Right 1181555893 22:23671513-23671535 CCCGAACAGCCCAGAAAGGCAGG 0: 2
1: 2
2: 2
3: 11
4: 162
1181555881_1181555895 16 Left 1181555881 22:23671475-23671497 CCATCCAGAAACATTAGCACCCC 0: 4
1: 0
2: 0
3: 6
4: 128
Right 1181555895 22:23671514-23671536 CCGAACAGCCCAGAAAGGCAGGG 0: 2
1: 2
2: 3
3: 14
4: 158
1181555881_1181555898 26 Left 1181555881 22:23671475-23671497 CCATCCAGAAACATTAGCACCCC 0: 4
1: 0
2: 0
3: 6
4: 128
Right 1181555898 22:23671524-23671546 CAGAAAGGCAGGGCCCAGAGAGG 0: 4
1: 0
2: 7
3: 64
4: 688

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181555881 Original CRISPR GGGGTGCTAATGTTTCTGGA TGG (reversed) Intergenic
900931442 1:5740407-5740429 GAGATGCTAAGATTTCTGGATGG + Intergenic
903029341 1:20451821-20451843 GGGTTGCAAATGCTCCTGGATGG - Intergenic
903304179 1:22401117-22401139 GGGCTGCTGGTGTGTCTGGATGG - Intergenic
910498081 1:87855667-87855689 CTGTTGCCAATGTTTCTGGAAGG + Intergenic
912619572 1:111140777-111140799 GCGGTGCTGATGTTTGTGGCTGG + Intronic
913470380 1:119180379-119180401 GGGGTCCTAATGTGTCTGGTTGG - Intergenic
915664709 1:157434006-157434028 GGGGTTGGAATGTCTCTGGAAGG - Intergenic
915734973 1:158078751-158078773 GGGGTCCTGCTGTGTCTGGATGG + Intronic
919313907 1:195947842-195947864 GGGGTGTTGATTTTTCTGGCTGG + Intergenic
923332760 1:232940710-232940732 GGGGTGCCAATGTTGCTGTGGGG + Intergenic
924005583 1:239606867-239606889 GTGGTGATAACGTTTTTGGATGG - Intronic
1063062668 10:2573937-2573959 GGTGTGCTAATGATTTTGGAAGG + Intergenic
1064626889 10:17270649-17270671 GGGGAGCTACTGTTTCTTTAGGG - Intergenic
1067932132 10:50572871-50572893 GGGGTGCTAGGTCTTCTGGAGGG - Intronic
1069858153 10:71453095-71453117 GGGGTGCTGGTGGTTCTGGCTGG - Intronic
1069958625 10:72066905-72066927 GTGGTGCTTCTGCTTCTGGAGGG - Exonic
1073191087 10:101651090-101651112 GGTGTGCTCCTGTTTCTCGAAGG - Intronic
1073471458 10:103725098-103725120 GGGGAGCCAGTGTTTCAGGAAGG + Intronic
1073685684 10:105751274-105751296 GGGATGCTGATGTTTATGGATGG + Intergenic
1074291050 10:112138252-112138274 TGGGTGCCAATGGGTCTGGATGG - Intergenic
1074538086 10:114343304-114343326 GAGGTGCCAAGGGTTCTGGATGG - Intronic
1077006865 11:362499-362521 TGGGAGCTGATGTTCCTGGAGGG - Intergenic
1080174376 11:29344020-29344042 GTGGAGCTAATATTTCTTGAAGG + Intergenic
1083466092 11:62847218-62847240 GGGTTTGGAATGTTTCTGGATGG + Intergenic
1084398548 11:68930602-68930624 GGGGTGTTGATTTTTCTGGCTGG + Intronic
1085302723 11:75467803-75467825 GAGGGGCTCCTGTTTCTGGAGGG - Intronic
1086352200 11:85953592-85953614 TGGGTGTTCATGTTTCTGGTTGG - Intergenic
1087036603 11:93762472-93762494 GGACTGCTAATGTTTGTGAAAGG - Exonic
1089536475 11:119163485-119163507 GGTGTGTTAATGGTTATGGAGGG + Intergenic
1093249420 12:16782621-16782643 GGGGTGCAACTGCTTCTTGATGG - Intergenic
1093920236 12:24851319-24851341 GGCTTTGTAATGTTTCTGGAGGG + Intronic
1101190993 12:102332335-102332357 TGGGTTCTAGTGTTTGTGGAAGG + Intergenic
1101492838 12:105225302-105225324 GGGGTAATAATGTTCCTGGCAGG - Intronic
1103927152 12:124429404-124429426 GGGGTGTTAATGTGTCTGAGAGG - Intronic
1105200900 13:18175928-18175950 GGGGTACTAATTTTAGTGGATGG - Intergenic
1105214178 13:18274702-18274724 GGGGTGCTAATGTTTCTGGATGG - Intergenic
1105424535 13:20283293-20283315 GGGGTGTTGATTTTTCTGGCTGG - Intergenic
1105791856 13:23808540-23808562 AGGGGGCTATTGTTTTTGGAGGG + Intronic
1106572092 13:30935871-30935893 GGGGTGTTGATTTTTCTGGCTGG - Intronic
1106620338 13:31365814-31365836 GGGGTGTCAATTTTTCTGGCCGG - Intergenic
1112576510 13:100641225-100641247 ATGGTGCTAATGTTTCTAGTGGG - Intronic
1115135656 14:30104753-30104775 AGGGTGCTAATATTTGTGAAGGG - Intronic
1117803880 14:59470261-59470283 GCGATGCTAATGTTGCTGGTTGG - Intronic
1119055793 14:71418624-71418646 GAATTGCTAATGTTTCTCGAAGG + Intronic
1119908432 14:78326594-78326616 GGGGTGCACATGTTTGTGCAGGG + Intronic
1129270552 15:74417249-74417271 GGGATCCTGATGTTTCTGGGAGG - Intronic
1135171341 16:20186712-20186734 GGGGTCCTAATGCTTCAGGTTGG + Intergenic
1142237917 16:88931378-88931400 GGTGTGCTTGTGTCTCTGGAAGG - Intronic
1143870383 17:9954003-9954025 GAGGTGCTGAGGTTACTGGAAGG + Intronic
1144362162 17:14505873-14505895 TGGGTGTTAATGTTTATAGAAGG - Intergenic
1144584959 17:16482347-16482369 GGGGTGGGAATGTGCCTGGAGGG + Intronic
1153000957 18:455033-455055 GGGATGGGAATGTTTCTGGCAGG - Intronic
1158111895 18:53949375-53949397 ATGGTGCTAATGCTCCTGGAAGG - Intergenic
1158571696 18:58601972-58601994 GGGGTGCTACTGCATCTGGCGGG - Intronic
1160773670 19:844704-844726 GGGGAGCTGATCTTTCTGGGTGG - Intronic
1160902713 19:1436721-1436743 GGGGAGCTAATGTAACGGGAGGG - Intergenic
1161002791 19:1919322-1919344 TGGCTGCTGATGTTTCTGCACGG + Intronic
1162135757 19:8554412-8554434 GGGGTGGTGATGTTTCAGCAGGG + Intronic
1164433557 19:28208813-28208835 GTGGTGCTCATCTTTTTGGAAGG + Intergenic
925454931 2:4008021-4008043 GGTGTGCACATGTTCCTGGAAGG + Intergenic
926113864 2:10198844-10198866 GGGGTAGGAATGTTTCTGGTTGG + Intronic
926114309 2:10202588-10202610 GGGGTGAGAAGGTTTCTGGTCGG + Intronic
926451142 2:13005796-13005818 GGGAAGCCAGTGTTTCTGGAAGG - Intergenic
927803906 2:26128049-26128071 TGGGTGGTATTGTTTCTGTAGGG + Intronic
928748672 2:34445764-34445786 AGGATGCTAATGTTTCTTCATGG - Intergenic
929868489 2:45737894-45737916 GGGGTGCTAAGGTTGGGGGAGGG - Intronic
930113908 2:47702381-47702403 GTGGTACTGATGTTACTGGATGG + Intronic
932048872 2:68379595-68379617 GGGGTGAGAATGTTTCTGTGAGG + Intronic
933528590 2:83476418-83476440 GTAATGCTAATTTTTCTGGAAGG + Intergenic
934116574 2:88802933-88802955 GGGGTACTAATTTTAGTGGATGG + Intergenic
934300141 2:91772048-91772070 GGGGTGCTAATGTTTCTGGATGG + Intergenic
934626038 2:95853619-95853641 GGGGTACTAATTTTAGTGGATGG - Intronic
934807534 2:97247696-97247718 GGGGTACTAATTTTAGTGGATGG + Intronic
934829976 2:97509491-97509513 GGGGTACTAATTTTAGTGGATGG - Intronic
934906314 2:98207406-98207428 GGGGTGCAAAAGATTCTGCATGG + Intronic
941547034 2:166864210-166864232 GGGGTGCTAACCTCTCTGAAAGG + Intergenic
942381736 2:175398875-175398897 GTGCTGCTGATGTTGCTGGATGG - Intergenic
944899345 2:204198481-204198503 GGGGTTCTACTTTTTCTGGCTGG - Intergenic
945782105 2:214188009-214188031 GGGCTTCTTATGGTTCTGGATGG - Intronic
1171823803 20:29877108-29877130 GGTGTGCTAATGATTGTGGTGGG + Intergenic
1173825644 20:46046077-46046099 GGGTTGCTAAAGTGTCTGGGTGG - Intronic
1176101370 20:63365990-63366012 GGGGTGCTCATGTCTGTGAAGGG - Intronic
1177529606 21:22342312-22342334 GGGGTGCTGAGGAATCTGGAGGG - Intergenic
1177710928 21:24773409-24773431 GGGAGGCTAATGTGTGTGGAAGG + Intergenic
1177782179 21:25633427-25633449 GAGTTGTTAATGTTTCTTGAAGG + Intergenic
1178637105 21:34313753-34313775 GGAGGGCTAATTGTTCTGGAAGG - Intergenic
1178674288 21:34617588-34617610 TGGGTGCCAGTGTTTCTGAAAGG + Intergenic
1181555881 22:23671475-23671497 GGGGTGCTAATGTTTCTGGATGG - Intergenic
1181698496 22:24607178-24607200 GGGGTGCTAATGTTTCTGGATGG + Intronic
1182039336 22:27224333-27224355 GGGGTGAAAATGCTTCTGAAGGG + Intergenic
1183672373 22:39280486-39280508 GGGGTGGAAATGACTCTGGATGG - Intergenic
1184345513 22:43910296-43910318 GGGTTGCTAATGATACTGGTGGG - Intergenic
949250802 3:1981210-1981232 GGGGTGCAAATATTTCTGAGAGG - Intergenic
949705106 3:6807555-6807577 CTGGTGCTTATATTTCTGGAAGG - Intronic
950320940 3:12052636-12052658 GGAGTGTTAAGGTATCTGGATGG + Intronic
952103744 3:30045125-30045147 CTGGTGCAAATGTTTCTGGCTGG - Intergenic
958045191 3:88275690-88275712 TTGGTGCTACTGTTGCTGGATGG - Intergenic
958143882 3:89599266-89599288 GGGGTGGTAATGTGTCTTCATGG - Intergenic
966820129 3:183917616-183917638 GGGGAGCTAAAGTTCCCGGAGGG + Intergenic
969398699 4:6939417-6939439 GGGGTGCGCATGCTTCTGGGGGG - Intronic
969705001 4:8786870-8786892 GGGCTGCTGATGTATGTGGAAGG - Intergenic
979760906 4:124403421-124403443 GGGGTTCTGATTTTTTTGGAAGG + Intergenic
982742356 4:159071169-159071191 TGCATGCTAATGTTTTTGGAGGG + Intergenic
983315812 4:166132024-166132046 GTGGTGCTATTGTTTTTGGATGG + Intergenic
986467359 5:8039034-8039056 GTTGTCCTAATGTTTCTAGATGG + Intergenic
987669517 5:20989210-20989232 GGGGTGTTGAAGTTTATGGAAGG - Intergenic
989009570 5:36855123-36855145 TGAGTGCTTATATTTCTGGAAGG - Intergenic
991069460 5:62460511-62460533 TTGGTGCTAATGTTTCTTAAGGG + Intronic
1000382607 5:160642532-160642554 GGGGTGCTAATGCATCTTGTGGG + Intronic
1004182761 6:13395251-13395273 TGGGGGCTAAGGTTTCAGGAGGG + Intronic
1004696988 6:18043031-18043053 GGGGTGTCAATTTTTCTGGTGGG - Intergenic
1005394502 6:25367451-25367473 GGGTTGCTGCTGTGTCTGGAAGG + Intronic
1010360183 6:74984533-74984555 GTGGTGTTAATGTTTTTAGATGG - Intergenic
1011864359 6:91804967-91804989 GGTTTTCTAATCTTTCTGGAAGG + Intergenic
1013903651 6:115188201-115188223 GTGGTGCTAATATTTTTTGATGG + Intergenic
1014540378 6:122668724-122668746 GATGTGCTAATATTCCTGGAAGG - Intronic
1018230105 6:161667097-161667119 GGGGGACTAGTGTTTCTGCAGGG - Intronic
1019585981 7:1803759-1803781 GGGTTTGGAATGTTTCTGGACGG + Intergenic
1021561331 7:21971602-21971624 GGGGTGTCAATTTTTCTGGGTGG + Intergenic
1022020587 7:26396996-26397018 GGGGTTCTGATGTTCCTGGAGGG + Intergenic
1022198678 7:28094960-28094982 GGGGTGCCAGTTTTTCTGGATGG - Intronic
1022563379 7:31373013-31373035 GGGCTGCAAAGGTTTCTGAAAGG + Intergenic
1022953930 7:35364216-35364238 GGGATGCTGATGCTTCTGGTTGG + Intergenic
1023468895 7:40491499-40491521 GGGATGCTAATGCATCTGAATGG + Intronic
1025217816 7:57073833-57073855 GTGGTGCTGATGCTGCTGGATGG - Intergenic
1025653536 7:63496629-63496651 GTGGTGCTGATGCTGCTGGATGG + Intergenic
1026359529 7:69590944-69590966 GGGGTGTCAATTTTTCTGGCCGG + Intergenic
1028085101 7:86626415-86626437 GGGGTGGTAGTGTAACTGGAAGG + Intergenic
1034693046 7:153029230-153029252 GGGGTGCTGTGGTTACTGGAAGG - Intergenic
1039249290 8:35643762-35643784 AGGATGCTAATGGTTCAGGAAGG + Intronic
1043787960 8:84425710-84425732 GGATTGATCATGTTTCTGGAGGG - Intronic
1048344966 8:133569671-133569693 GGGGTCCTAATGTTTGGGGCAGG + Intronic
1050958750 9:11699781-11699803 TGGTTTCTAATCTTTCTGGAAGG + Intergenic
1056590112 9:87960057-87960079 GGGGTTGGAATGTTTCTGGTTGG + Intergenic
1059721350 9:116963167-116963189 GAGGTGCCTATGATTCTGGAGGG + Intronic
1062293174 9:135806939-135806961 GGGGTGCTGACGCTTCGGGATGG - Intergenic
1203583451 Un_KI270746v1:38009-38031 GGGGTACTAATTTTAGTGGATGG + Intergenic
1189680559 X:43511834-43511856 GGGGTTCTAATTATTCTAGAAGG - Intergenic