ID: 1181558266

View in Genome Browser
Species Human (GRCh38)
Location 22:23684583-23684605
Sequence CCTGCAAGCAGGTGTTCATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181558266_1181558276 25 Left 1181558266 22:23684583-23684605 CCACATGAACACCTGCTTGCAGG No data
Right 1181558276 22:23684631-23684653 CACCTCTGTTCTCACTCCCAGGG No data
1181558266_1181558270 -10 Left 1181558266 22:23684583-23684605 CCACATGAACACCTGCTTGCAGG No data
Right 1181558270 22:23684596-23684618 TGCTTGCAGGAAGCCAAAGTGGG No data
1181558266_1181558275 24 Left 1181558266 22:23684583-23684605 CCACATGAACACCTGCTTGCAGG No data
Right 1181558275 22:23684630-23684652 CCACCTCTGTTCTCACTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181558266 Original CRISPR CCTGCAAGCAGGTGTTCATG TGG (reversed) Intergenic