ID: 1181558270

View in Genome Browser
Species Human (GRCh38)
Location 22:23684596-23684618
Sequence TGCTTGCAGGAAGCCAAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181558261_1181558270 6 Left 1181558261 22:23684567-23684589 CCAACCGCCTTGCTCCCCACATG No data
Right 1181558270 22:23684596-23684618 TGCTTGCAGGAAGCCAAAGTGGG No data
1181558258_1181558270 11 Left 1181558258 22:23684562-23684584 CCCACCCAACCGCCTTGCTCCCC No data
Right 1181558270 22:23684596-23684618 TGCTTGCAGGAAGCCAAAGTGGG No data
1181558255_1181558270 23 Left 1181558255 22:23684550-23684572 CCAGCTTTGTCCCCCACCCAACC No data
Right 1181558270 22:23684596-23684618 TGCTTGCAGGAAGCCAAAGTGGG No data
1181558265_1181558270 -9 Left 1181558265 22:23684582-23684604 CCCACATGAACACCTGCTTGCAG No data
Right 1181558270 22:23684596-23684618 TGCTTGCAGGAAGCCAAAGTGGG No data
1181558259_1181558270 10 Left 1181558259 22:23684563-23684585 CCACCCAACCGCCTTGCTCCCCA No data
Right 1181558270 22:23684596-23684618 TGCTTGCAGGAAGCCAAAGTGGG No data
1181558262_1181558270 2 Left 1181558262 22:23684571-23684593 CCGCCTTGCTCCCCACATGAACA No data
Right 1181558270 22:23684596-23684618 TGCTTGCAGGAAGCCAAAGTGGG No data
1181558257_1181558270 12 Left 1181558257 22:23684561-23684583 CCCCACCCAACCGCCTTGCTCCC No data
Right 1181558270 22:23684596-23684618 TGCTTGCAGGAAGCCAAAGTGGG No data
1181558260_1181558270 7 Left 1181558260 22:23684566-23684588 CCCAACCGCCTTGCTCCCCACAT No data
Right 1181558270 22:23684596-23684618 TGCTTGCAGGAAGCCAAAGTGGG No data
1181558264_1181558270 -8 Left 1181558264 22:23684581-23684603 CCCCACATGAACACCTGCTTGCA No data
Right 1181558270 22:23684596-23684618 TGCTTGCAGGAAGCCAAAGTGGG No data
1181558266_1181558270 -10 Left 1181558266 22:23684583-23684605 CCACATGAACACCTGCTTGCAGG No data
Right 1181558270 22:23684596-23684618 TGCTTGCAGGAAGCCAAAGTGGG No data
1181558256_1181558270 13 Left 1181558256 22:23684560-23684582 CCCCCACCCAACCGCCTTGCTCC No data
Right 1181558270 22:23684596-23684618 TGCTTGCAGGAAGCCAAAGTGGG No data
1181558263_1181558270 -1 Left 1181558263 22:23684574-23684596 CCTTGCTCCCCACATGAACACCT No data
Right 1181558270 22:23684596-23684618 TGCTTGCAGGAAGCCAAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181558270 Original CRISPR TGCTTGCAGGAAGCCAAAGT GGG Intergenic