ID: 1181558275

View in Genome Browser
Species Human (GRCh38)
Location 22:23684630-23684652
Sequence CCACCTCTGTTCTCACTCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181558268_1181558275 13 Left 1181558268 22:23684594-23684616 CCTGCTTGCAGGAAGCCAAAGTG No data
Right 1181558275 22:23684630-23684652 CCACCTCTGTTCTCACTCCCAGG No data
1181558266_1181558275 24 Left 1181558266 22:23684583-23684605 CCACATGAACACCTGCTTGCAGG No data
Right 1181558275 22:23684630-23684652 CCACCTCTGTTCTCACTCCCAGG No data
1181558265_1181558275 25 Left 1181558265 22:23684582-23684604 CCCACATGAACACCTGCTTGCAG No data
Right 1181558275 22:23684630-23684652 CCACCTCTGTTCTCACTCCCAGG No data
1181558271_1181558275 -2 Left 1181558271 22:23684609-23684631 CCAAAGTGGGTCCACAGCAGCCC No data
Right 1181558275 22:23684630-23684652 CCACCTCTGTTCTCACTCCCAGG No data
1181558264_1181558275 26 Left 1181558264 22:23684581-23684603 CCCCACATGAACACCTGCTTGCA No data
Right 1181558275 22:23684630-23684652 CCACCTCTGTTCTCACTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181558275 Original CRISPR CCACCTCTGTTCTCACTCCC AGG Intergenic