ID: 1181560579

View in Genome Browser
Species Human (GRCh38)
Location 22:23697357-23697379
Sequence AGCCTCACAGCTGCTCCTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 332
Summary {0: 1, 1: 0, 2: 3, 3: 29, 4: 299}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181560569_1181560579 27 Left 1181560569 22:23697307-23697329 CCTGGACCGAGCCTTTAGATCTC 0: 1
1: 0
2: 0
3: 5
4: 55
Right 1181560579 22:23697357-23697379 AGCCTCACAGCTGCTCCTGTGGG 0: 1
1: 0
2: 3
3: 29
4: 299
1181560575_1181560579 -9 Left 1181560575 22:23697343-23697365 CCTCCTCTCCTAAGAGCCTCACA 0: 1
1: 0
2: 2
3: 21
4: 309
Right 1181560579 22:23697357-23697379 AGCCTCACAGCTGCTCCTGTGGG 0: 1
1: 0
2: 3
3: 29
4: 299
1181560572_1181560579 16 Left 1181560572 22:23697318-23697340 CCTTTAGATCTCAGCCCTTGGCA 0: 1
1: 2
2: 1
3: 14
4: 148
Right 1181560579 22:23697357-23697379 AGCCTCACAGCTGCTCCTGTGGG 0: 1
1: 0
2: 3
3: 29
4: 299
1181560574_1181560579 1 Left 1181560574 22:23697333-23697355 CCTTGGCAAACCTCCTCTCCTAA 0: 1
1: 0
2: 2
3: 12
4: 191
Right 1181560579 22:23697357-23697379 AGCCTCACAGCTGCTCCTGTGGG 0: 1
1: 0
2: 3
3: 29
4: 299
1181560573_1181560579 2 Left 1181560573 22:23697332-23697354 CCCTTGGCAAACCTCCTCTCCTA 0: 1
1: 0
2: 0
3: 14
4: 182
Right 1181560579 22:23697357-23697379 AGCCTCACAGCTGCTCCTGTGGG 0: 1
1: 0
2: 3
3: 29
4: 299
1181560570_1181560579 21 Left 1181560570 22:23697313-23697335 CCGAGCCTTTAGATCTCAGCCCT 0: 1
1: 1
2: 1
3: 20
4: 173
Right 1181560579 22:23697357-23697379 AGCCTCACAGCTGCTCCTGTGGG 0: 1
1: 0
2: 3
3: 29
4: 299

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181560579 Original CRISPR AGCCTCACAGCTGCTCCTGT GGG Intronic
900029877 1:363658-363680 GGCCTCAGAGCTGCTTCAGTGGG + Intergenic
900050528 1:592722-592744 GGCCTCAGAGCTGCTTCAGTGGG + Intergenic
900170913 1:1268323-1268345 AGCCTCAGACCAGCTCCTGAGGG + Intronic
900409272 1:2505400-2505422 AGCCTCGAAGCCCCTCCTGTGGG - Exonic
900413663 1:2525358-2525380 AGACACACCGCTGCTCTTGTGGG + Intronic
900504874 1:3024957-3024979 AGCCTCACTGCTGCTGCTGGGGG + Intergenic
900856972 1:5194093-5194115 GGCCTCACAGCTGCTCCTCGAGG - Intergenic
900922605 1:5683099-5683121 AGCGTCACTGCTGCTGCTGATGG - Intergenic
901760908 1:11470828-11470850 ATCCTCACAGCTGCTCTTTGAGG + Intergenic
901872071 1:12144031-12144053 TGCCTTACAGCTGCGGCTGTGGG - Exonic
901928517 1:12582564-12582586 AACCTCCCAGCTTCTCCTGGAGG - Intronic
902206308 1:14870677-14870699 AGCATCACAGCAGCTCATGAGGG - Intronic
903739989 1:25553088-25553110 AGCCTCCCACATGCCCCTGTTGG + Intronic
904260995 1:29287540-29287562 GGCCTCACAGCAGTCCCTGTGGG + Intronic
904424610 1:30415395-30415417 GGCCTCACTACTGCCCCTGTGGG - Intergenic
905786843 1:40765205-40765227 AGCCTCCCAGCAGCTTCTCTTGG + Intronic
905921150 1:41719763-41719785 AACCTCACAGCAGCCCCAGTGGG + Intronic
907281562 1:53350391-53350413 TGCCTCCCAGTTGCACCTGTTGG + Intergenic
907815101 1:57910934-57910956 AGCCTCACATCTGCCCCTGTAGG - Intronic
911409806 1:97488885-97488907 TGCCTCTCAGCTGCTGCTCTGGG + Intronic
912460986 1:109831378-109831400 AGCCTCAAAGCTGCCCTTGTAGG + Intergenic
913149930 1:116031491-116031513 AGTCTCCCTGCAGCTCCTGTTGG - Exonic
913228775 1:116723681-116723703 ATCCTCACAACTGCTCCTCGAGG - Intergenic
913531280 1:119735968-119735990 AGCCTCACACCAGATCCAGTAGG + Intronic
915679096 1:157562828-157562850 AGCCTCTCAGGAGCTCCTGGAGG + Intergenic
916410521 1:164542697-164542719 TGCCTCTGAGCTGCTCCTCTGGG + Intergenic
917227503 1:172800436-172800458 AGGCTGACAGGTCCTCCTGTGGG - Intergenic
917968950 1:180195196-180195218 AGGCTCCCAGCTGCTGCTGGAGG + Intronic
919365812 1:196659533-196659555 TGCCTCTGAGCTGCTACTGTGGG - Intronic
919473275 1:198005026-198005048 AACCTCATAGCTGGTTCTGTGGG + Intergenic
920071468 1:203305837-203305859 AGTCCCAAAGCTGCTCCCGTGGG - Intronic
920184328 1:204151125-204151147 AGGCTCTGAGCTGCCCCTGTGGG - Intronic
920275667 1:204802665-204802687 AGGCTCAGAGATGCTCCTCTTGG + Intergenic
920926864 1:210349588-210349610 AGCCTCCCAGCTGTGCCCGTGGG - Intronic
921051889 1:211516771-211516793 ACCCTCACAGCTACTCCTTGGGG - Intergenic
922221452 1:223611484-223611506 TGCCTGTCAGCTGCTACTGTGGG + Intronic
923811350 1:237320828-237320850 AGCCTCACATGAGCTCCTCTGGG - Intronic
1063197013 10:3752993-3753015 AGCCTGACACCTGCTCCTCACGG - Intergenic
1063245347 10:4212328-4212350 AGCCCCACAGATGATCCTGAAGG + Intergenic
1063450771 10:6148520-6148542 GGGCTCACAGCTCTTCCTGTGGG + Intronic
1064158652 10:12924664-12924686 TGCCTCACAGATACTCCAGTTGG - Intronic
1064688913 10:17893555-17893577 ATCCTCATACCTGGTCCTGTTGG - Intronic
1065998690 10:31084063-31084085 AGCCTCACCGCCCCTCCTCTTGG + Intergenic
1067064049 10:43093740-43093762 AGCCTCACTGCTGCTGCTGAGGG - Intronic
1067197302 10:44133113-44133135 AACCTCACAGCTTCTCCACTGGG - Intergenic
1070550620 10:77488250-77488272 ATCCTCACAGCTCCTCCTAAAGG - Intronic
1070689888 10:78516646-78516668 AGCTCCACAGCTGCGCCTGATGG + Intergenic
1072415231 10:95241668-95241690 AGGCTCACATCTGCTCACGTTGG - Intronic
1072614289 10:97039143-97039165 AGCCTCATCGCTGGTCCTGGGGG + Intronic
1072615686 10:97047761-97047783 GGCCTCACAGCGGCACTTGTGGG + Exonic
1072753585 10:98001939-98001961 AGCATCACTGCTGCTCCAGGGGG - Intronic
1073100520 10:101004000-101004022 CCCCTGACAGCAGCTCCTGTGGG + Exonic
1074867382 10:117552870-117552892 AGCCTCACAACTGCACGTGCTGG - Intergenic
1075093869 10:119458540-119458562 GGCCTCACAGCTGTGTCTGTGGG - Intronic
1075616778 10:123895663-123895685 AGACTCACAGCCCCTCCTGAGGG - Intronic
1076109255 10:127848688-127848710 ACCCTCACGGCTGCTCCCCTTGG + Intergenic
1076376698 10:129993096-129993118 AGCCACACAGCTGCTGCTAGGGG - Intergenic
1076417238 10:130300693-130300715 AGCCTCCCAGCAGCGCCTGCAGG - Intergenic
1076417569 10:130301889-130301911 AGCCTCCCAGCTGGGCCTGAAGG - Intergenic
1076420736 10:130329987-130330009 TGCCTCACAGCTGTTCCTGGCGG - Intergenic
1076606773 10:131694571-131694593 AGCTCCACATCTGCTCCTGGGGG - Intergenic
1076798634 10:132810699-132810721 CGCCTCACAGCTGTCCCTGGAGG - Intronic
1076944616 10:133637693-133637715 AGCCTCACAGATGTTCCAGCTGG + Intergenic
1077057509 11:602039-602061 AAACCCACAGCTGCTCCTGGGGG - Intronic
1077094506 11:793604-793626 AAGTTCACAGCAGCTCCTGTGGG + Exonic
1077182420 11:1222706-1222728 AGCCCCACTGCGGCTCCTGCTGG - Intergenic
1079242874 11:18733096-18733118 AGCCTCACATCTCCTCATCTTGG + Intronic
1079283644 11:19109593-19109615 AGCCTGAGAGCTCTTCCTGTTGG + Intergenic
1081366932 11:42247007-42247029 ATCCTCACAGCAGCCTCTGTAGG + Intergenic
1081659855 11:44881377-44881399 AGCTGCCCAGCTGCTCCTGGAGG - Intronic
1081934421 11:46895170-46895192 AGCCTTGCAGCTGCGCCGGTCGG + Exonic
1083212235 11:61195444-61195466 ACCCTCAAAGCTGCTGCTGCAGG + Intergenic
1083609353 11:63997810-63997832 CCCCTCAAACCTGCTCCTGTTGG - Exonic
1083694737 11:64435142-64435164 AGTCTCACACGTGCTCCCGTCGG - Intergenic
1083878732 11:65538007-65538029 AGCTTCCCAGCTGCTCCAGTCGG - Exonic
1084321787 11:68377359-68377381 TGCCTGCCAGCTGCTCCTGGAGG + Intronic
1085051029 11:73380338-73380360 AGACTCACGGCCACTCCTGTGGG + Intronic
1085389439 11:76175067-76175089 ACCCTCACAGCTGCTCCCACTGG - Intergenic
1085585985 11:77706407-77706429 ATCCTCACAGCTCCTCCTTGAGG - Intronic
1086307536 11:85497904-85497926 TGCCTCACAGGAGCTCCTGAAGG + Intronic
1089539890 11:119183406-119183428 AGCTTCCCAGCTGCTCCAGGAGG - Exonic
1090995560 11:131862888-131862910 TGCCTCACAGATGTTCCTATAGG + Intronic
1091389548 12:117689-117711 GGTCTCACAGCTGCTCCTAAAGG - Intronic
1094177926 12:27560799-27560821 AAGCTAACAGCAGCTCCTGTGGG - Intronic
1094780987 12:33791251-33791273 AACCTCCCAACTGCTCCTGAAGG - Intergenic
1095565750 12:43621535-43621557 AACCCCACTGCTGCTGCTGTAGG - Intergenic
1095913763 12:47455967-47455989 AGCCTCACAAGTGCTCCTGAAGG - Intergenic
1095942075 12:47733864-47733886 AGGCCCAGAGCTGCTCCCGTTGG - Intergenic
1096355131 12:50934626-50934648 AGCCTCAGAGCTTCTCCTCTTGG - Intergenic
1099307133 12:80971443-80971465 TGCCTCTCAGCTGCTACTCTGGG - Intronic
1099424078 12:82501464-82501486 AGCCTCCCAGCTTCTCCTTGTGG + Intergenic
1101909551 12:108850895-108850917 CACCTCACAGCGGCTCCTGTGGG - Intronic
1102569373 12:113818273-113818295 AGACAGGCAGCTGCTCCTGTGGG + Intronic
1102830866 12:115998009-115998031 AAACTCACAGCTGCTCTTTTGGG + Intronic
1103008309 12:117439110-117439132 AGCCTCAGAGCTCATGCTGTGGG - Intronic
1104981190 12:132573760-132573782 AGGCTCACAGCAGCTCCTCCTGG + Intronic
1105311697 13:19217923-19217945 AGACTAACAGCTGATCCTCTTGG - Intergenic
1105599686 13:21875688-21875710 AGCCTCAGAGGGGCTCCTGCAGG - Intergenic
1107049955 13:36036250-36036272 TGCCTCTGAGCTGCTCCTCTGGG + Intronic
1108377937 13:49830482-49830504 AGCCAGTCAACTGCTCCTGTGGG - Intergenic
1112428907 13:99332485-99332507 AGGGTCACAGCTTCTGCTGTTGG + Intronic
1113156796 13:107332525-107332547 GGCCCCACAGCTGCTCCTGAGGG - Intronic
1113331200 13:109329560-109329582 AGCCTCAAAGCTGGTGCTGTAGG + Intergenic
1115565325 14:34620325-34620347 TGCCTCACAGCTGGTCATGGTGG + Intronic
1115649192 14:35390851-35390873 AGCCTCAAGGCAGCTCCCGTGGG + Intergenic
1116164221 14:41312207-41312229 ACCCTCCCAGCTGCTTTTGTAGG - Intergenic
1117574300 14:57082711-57082733 ATCCTCAGAGCTGCTGCTGGTGG - Intergenic
1119947107 14:78706465-78706487 AGCCTCACAGGTGCTGCTAGTGG + Intronic
1122830009 14:104391267-104391289 AGCCTCACTGCTTCAACTGTGGG + Intergenic
1122854183 14:104552264-104552286 ACCCTCACAGCAGCACCCGTGGG - Intronic
1122909837 14:104822125-104822147 AGCCTCACAGCTCTGTCTGTGGG + Intergenic
1125723173 15:41854824-41854846 AGCCTCAATGCGGCTCCTCTGGG + Exonic
1125770004 15:42159007-42159029 AGCTTCCCTGCTGCTCCTGGAGG + Exonic
1127230376 15:56985880-56985902 AGCCTCACAGTTGGTCCTGTTGG - Intronic
1127899659 15:63331527-63331549 AGCCCCAGAGCTCCTTCTGTTGG - Intronic
1128260083 15:66227267-66227289 ATCCTCACAGCAGCTCCAGGAGG - Intronic
1128995328 15:72290494-72290516 AGGCTCAGGGCTGCTCTTGTGGG + Intronic
1129061922 15:72867200-72867222 TGCTTTGCAGCTGCTCCTGTGGG + Intergenic
1129468528 15:75737853-75737875 AGCCTGGCCTCTGCTCCTGTGGG + Intergenic
1129727052 15:77906654-77906676 AGCCTGGCCTCTGCTCCTGTGGG - Intergenic
1131446172 15:92499626-92499648 AGCCCCACATCTGCTCCGGGTGG - Intronic
1132124470 15:99210504-99210526 CTCCTGTCAGCTGCTCCTGTGGG - Intronic
1132354832 15:101163477-101163499 AGCCTCAGAGGTGCCCCTGAGGG + Intergenic
1133764664 16:8829571-8829593 AGGCTCACACTTGCTCCCGTTGG + Intronic
1135191229 16:20356389-20356411 ATACTAACACCTGCTCCTGTTGG + Intergenic
1135405946 16:22197975-22197997 ATCCTCACAGCAAATCCTGTGGG - Intergenic
1138524066 16:57591663-57591685 GGCCTCAGACCTGCTCTTGTTGG - Intronic
1138850809 16:60627398-60627420 TGCCTCTGAGCTGCTACTGTGGG - Intergenic
1139388491 16:66589590-66589612 AGCCTCACAGCATCCCCTGCAGG + Intergenic
1139668147 16:68472599-68472621 AGCCCCTCAGCTGCTCCAGCTGG - Intergenic
1140232808 16:73131875-73131897 AGCCTCACAACAGCTCCAGGAGG - Intronic
1141858598 16:86701442-86701464 ACCTCCACACCTGCTCCTGTCGG + Intergenic
1142026462 16:87816744-87816766 AGAGGCACAGCTGCTCCTGCCGG + Intergenic
1144347100 17:14359333-14359355 TGCCTCACAGCGGCACCTGGAGG + Intergenic
1144829616 17:18123946-18123968 AGGCACACAGGTGTTCCTGTAGG - Intronic
1145246422 17:21272810-21272832 AGGCTCACAGCAGCCCCTGAGGG + Intergenic
1146631734 17:34474885-34474907 AGGCTCACAGCTGCCCCTCCTGG - Intergenic
1147551292 17:41444064-41444086 AGCCTCACACCTGCCTCTGATGG + Intergenic
1147643823 17:42021747-42021769 AGGCTAAAAGCTGCTCCTGGTGG + Intronic
1148841718 17:50502987-50503009 AGGCTCACTGATGCTCCTGCAGG + Intergenic
1149997984 17:61414866-61414888 TGTTCCACAGCTGCTCCTGTCGG - Intergenic
1152007829 17:77693586-77693608 AGCCTGAGAGCTGCCCCAGTTGG - Intergenic
1152269212 17:79313872-79313894 AGCCCCACAGTAGCTCCTGGAGG - Intronic
1152949880 17:83222902-83222924 GGCCTCAGAGCTGCTTCAGTGGG - Intergenic
1153623499 18:7002234-7002256 AGCATGCCAGCTGCCCCTGTGGG + Intronic
1153953367 18:10075792-10075814 GGCCTCACAGCCGCTCCTCAGGG + Intergenic
1154024976 18:10698435-10698457 TGCCTCACAGCTGCCCCTCTTGG - Intronic
1154931786 18:21005516-21005538 ACCCTCACAGGTACTCCTGCAGG - Intronic
1155529972 18:26757156-26757178 TGCATCAAAGCTGCTCCTTTTGG - Intergenic
1157089953 18:44625580-44625602 AGCCTGGCAGCTGCACCTGGAGG - Intergenic
1158171177 18:54602642-54602664 AGCCTCACAGATGCTGCCATCGG - Intergenic
1160041510 18:75349815-75349837 AGGCTCGCTGCTGCTCCTGCTGG - Intergenic
1160442216 18:78901617-78901639 AGCCTCCCACCTGCTGGTGTGGG - Intergenic
1160949062 19:1657105-1657127 AGCCTCACACCTCCTGCTGTAGG + Intergenic
1161128801 19:2576161-2576183 AGCCTCACAACTCCTGCTCTGGG - Intronic
1162164808 19:8745040-8745062 AGCCCCAAAGCTGCTCCCGAAGG + Intergenic
1162165879 19:8752508-8752530 AGCCCCAAAGCTGCTCCCGAAGG + Intergenic
1162166945 19:8759964-8759986 AGCCCCAAAGCTGCTCCCGAAGG + Intergenic
1162168011 19:8767424-8767446 AGCCCCAAAGCTGCTCCCGAAGG + Intergenic
1162168950 19:8773718-8773740 AGCCCCAAAGCTGCTCCCGAAGG + Intergenic
1162169634 19:8779032-8779054 AGCCCCAAAGCTGCTCCCGAAGG + Intergenic
1162170696 19:8786486-8786508 AGCCCCAAAGCTGCTCCCGAAGG + Intergenic
1162344112 19:10109914-10109936 AGCATCAAAGTTGTTCCTGTGGG + Exonic
1162444230 19:10712614-10712636 AGCCTCACCGCTGTCCGTGTGGG - Exonic
1164893207 19:31842880-31842902 GGCTTCACTGCTGCTGCTGTTGG - Intergenic
1165200757 19:34142463-34142485 TGCCTCTGAGCTGCTCCTCTGGG - Intergenic
1165404285 19:35620194-35620216 GGCCTCGGAGCTGCTCCTGCCGG + Exonic
1165975605 19:39673641-39673663 AGCCTCACAGATGGTCCAGCAGG + Intergenic
1167622321 19:50567080-50567102 ACCCTCACACCTGCTCTTCTAGG - Intronic
926747493 2:16170988-16171010 AGCCTCACAGCTGCTCCGGGAGG + Intergenic
929030851 2:37648876-37648898 GGCCACCCAGCTGCTCCTGCAGG - Intronic
930991547 2:57662514-57662536 AGACTGACAGCTGCTCTTCTGGG - Intergenic
932572382 2:72944938-72944960 AGACTCACGGCTGCACCTGCAGG - Exonic
934946910 2:98549037-98549059 ATCCCCACACCTCCTCCTGTGGG + Intronic
935619772 2:105119001-105119023 GGCCTCTCAGCTGCGTCTGTAGG - Intergenic
936261415 2:110962551-110962573 AGCATCAGTCCTGCTCCTGTGGG - Intronic
938147428 2:128848441-128848463 AGCTTCCCAGCAGCTGCTGTGGG + Intergenic
938684735 2:133727310-133727332 AGACTCACATCTGCTTCTTTGGG - Intergenic
939035276 2:137123224-137123246 AGCCTCTCAGCTGCTACTCAAGG - Intronic
940061601 2:149576960-149576982 AGCCTCTAAGCTCTTCCTGTAGG - Intronic
941251070 2:163163433-163163455 GGCCTCACAGCAGCTCCTTAGGG - Intergenic
944048444 2:195439785-195439807 AGGCTCCCAGCTGATCCTGGCGG - Intergenic
947774667 2:232697837-232697859 GGCCAGACAGCTGCTCCTGCCGG + Intronic
948266839 2:236641173-236641195 CTCCTCACAGCTGCAGCTGTGGG - Intergenic
948854709 2:240724788-240724810 AGCCACCCAGCAGGTCCTGTGGG + Intronic
1169227253 20:3864466-3864488 AGCCTATCATCTGCTCCAGTGGG + Exonic
1169270981 20:4199247-4199269 TGCCTCTGAGCTGCTCCTCTGGG - Intergenic
1169276014 20:4234202-4234224 AGCGTCCCAGCAGCTCCTGCAGG - Intronic
1170706893 20:18751924-18751946 AAACTCAAAGCTGCTCCTCTAGG - Intronic
1170761023 20:19251764-19251786 AGTCTCCCAGCTCCTCCTGGAGG - Intronic
1171359097 20:24574058-24574080 AGCCTGGAGGCTGCTCCTGTTGG - Intronic
1171883667 20:30636067-30636089 AGCCCCACAGCTGTTCTCGTGGG - Intergenic
1171935062 20:31267198-31267220 TGCCTCACAGGAGCTCCTGAAGG - Intergenic
1172430213 20:34884277-34884299 AGCATCCAAGCTGCTCCTATTGG - Intronic
1172698694 20:36839474-36839496 GGCCTCCTAGCTGCTACTGTGGG - Intronic
1173637832 20:44576575-44576597 AGCCTCAAACCTTCTCCTGTTGG + Intronic
1173950825 20:46992034-46992056 AGCCTCTCAGCTCCTACTGGTGG - Intronic
1175200994 20:57277602-57277624 AGCATCCCAGATGCTCTTGTGGG - Intergenic
1175392290 20:58635106-58635128 TGCCTCACACCTGCTGCTGTGGG + Intergenic
1175540686 20:59745859-59745881 AGCCTCGCAGCTGCATCTTTGGG + Intronic
1176031485 20:63015150-63015172 GGCCTGGCAGCTGCTGCTGTGGG + Intergenic
1176258981 20:64169095-64169117 AGCCTCTCACCTGGTCCTGGGGG + Intronic
1176719135 21:10379195-10379217 GGCCCCACAGCTGCTCTGGTTGG - Intergenic
1176946627 21:14990140-14990162 AGCCTAAGAGCTGCTCCAGAAGG + Intronic
1179413543 21:41180065-41180087 TGCCTCTGAGCTGCTACTGTGGG - Intronic
1179766470 21:43577523-43577545 AGCCTTACAGTTGATGCTGTTGG - Intronic
1181560579 22:23697357-23697379 AGCCTCACAGCTGCTCCTGTGGG + Intronic
1181769820 22:25117287-25117309 AACCACACAGCTGCCCCTGTGGG + Intronic
1183509172 22:38225088-38225110 AGGGCCACAGCTGCTCCTGCAGG + Intronic
1183748130 22:39704069-39704091 GGGCTCACAGCTGCTCTTGCAGG - Intergenic
1184358182 22:43996392-43996414 AGTCCCAGAGCTTCTCCTGTAGG - Exonic
1184464259 22:44659625-44659647 ACCCACAGGGCTGCTCCTGTTGG - Intergenic
1184672454 22:46022050-46022072 AGGCTCATACCTGCTCCTGACGG - Intergenic
1185305426 22:50112765-50112787 AGCTCCGCAGCTTCTCCTGTGGG + Intronic
950550782 3:13664692-13664714 GGCAGCTCAGCTGCTCCTGTTGG - Intergenic
953181142 3:40596399-40596421 AGACTCAGAGCTGCTGTTGTTGG + Intergenic
954149278 3:48649200-48649222 AGCCGCACAGCAGCACCTGGAGG + Exonic
955933549 3:64080832-64080854 AGCCTCAAAGCTTCTCATGCAGG - Intergenic
957707874 3:83813485-83813507 AGCCCCACAGCAGATCCTGAAGG - Intergenic
957911088 3:86620773-86620795 AGTCTCACAGATGGTCCAGTAGG + Intergenic
958095291 3:88936231-88936253 AGCCACACAGCTCCTCCTTTAGG - Intergenic
958548562 3:95588625-95588647 AGCCCCCCAGCTTCCCCTGTGGG - Intergenic
960056021 3:113276997-113277019 AGCCTCTCAGCATCACCTGTTGG + Intronic
960621706 3:119643207-119643229 AACCTTACAGCTGCTTCTGAGGG + Intronic
961531991 3:127545552-127545574 AGCCTAACAGTTCCTCCTGGTGG - Intergenic
961818666 3:129564193-129564215 AGCCCCACGGCTCCTCCTGGGGG - Intronic
962843523 3:139255808-139255830 GGCCTGGCAGCTGCTCCTGCTGG + Intronic
964488007 3:157205873-157205895 AGGGCCACAGCTGATCCTGTTGG + Intergenic
964978089 3:162643775-162643797 TGCCTCAGAGCTGCTACTGTGGG - Intergenic
966197098 3:177324417-177324439 AGCATCACAGATCCTCCCGTTGG + Intergenic
967828951 3:193902469-193902491 AGCCTCCCTCCTGCTCCTGCTGG + Intergenic
969465259 4:7352702-7352724 AGCCTCACACCTGCTGCAGCTGG + Intronic
969720406 4:8890421-8890443 AACCTGACAGCTGCTCCAGCTGG + Intergenic
972557111 4:40192976-40192998 AGCCTCACAGCTGCCCTTTATGG - Intronic
972894819 4:43607002-43607024 AACCCCACAGCTGCTACTGTTGG + Intergenic
978954186 4:114595245-114595267 AGCCATACAGCTGGTCCTATGGG + Intergenic
981952243 4:150423256-150423278 CGCCTCCCAGCATCTCCTGTAGG + Intronic
982115468 4:152095187-152095209 GCCCTCACACCTGCTGCTGTAGG - Intergenic
983153651 4:164317412-164317434 CACCTCACAGCTGTTCCTGGAGG + Intronic
985422003 4:189793982-189794004 AGCCTCACAACTGCACCTTGGGG + Intergenic
985448002 4:190038203-190038225 AGCCTCACAGATGTTCCAGCTGG + Intergenic
985571123 5:645874-645896 AGCGTCACTCCTGCTCCCGTCGG + Intronic
985571132 5:645939-645961 AGCGTCACTCCTGCTCCCGTTGG + Intronic
985789090 5:1915806-1915828 AGCCTCAGAGCTGCCCCGGGAGG + Intergenic
985941302 5:3138527-3138549 AGCCTCACATCCGCCTCTGTGGG - Intergenic
985994724 5:3591571-3591593 GGCCTCCCAGCTGCTGCTGAGGG + Intergenic
986181470 5:5396962-5396984 AGCCTCCCAGCTGTTCCTATAGG + Intergenic
986283280 5:6340813-6340835 AGCTTCTAAGCTGCTCCTCTTGG - Intergenic
986531475 5:8740837-8740859 AGGCTCACAGGTGGTCCTGTTGG + Intergenic
987792236 5:22582544-22582566 AGGCTCTCAGGTACTCCTGTGGG - Intronic
992392451 5:76341755-76341777 TGGCTCACATCTGCTCCTGGAGG + Intronic
993020437 5:82584831-82584853 AGCATCACTGCAGCTCCAGTTGG - Intergenic
994211330 5:97090145-97090167 AGACTCACAGCTGCTCCTTGTGG + Intronic
998214627 5:140227791-140227813 ACACTCAAAGCTGCTCCTGGGGG - Intronic
998470840 5:142382597-142382619 GGCCTCACAGTTGCTCCTCCAGG - Intergenic
998975339 5:147639658-147639680 TGCCTCCCGTCTGCTCCTGTAGG + Exonic
999204598 5:149839051-149839073 AGCTTCACAGGTGCACCTGGAGG + Intronic
999326163 5:150645015-150645037 AGCGTCACAGCAGCTCCACTGGG - Intronic
999684077 5:154086814-154086836 AGCCCAACATCTGCTCCTCTGGG - Intronic
999883947 5:155899187-155899209 AGAGTGAAAGCTGCTCCTGTTGG + Intronic
1001255709 5:170182063-170182085 CATCTCACAGCTGCTGCTGTGGG + Intergenic
1001441081 5:171743529-171743551 CCCCTCACAGCTCCTCCTGAAGG + Intergenic
1002292748 5:178210865-178210887 AGCCTCCCACCTGCTTCTGGGGG - Exonic
1002602450 5:180361776-180361798 TGCATCACAGCTGCCCCTCTGGG - Intergenic
1002670695 5:180864062-180864084 AACCTCACTGCTGCACCTATTGG - Intergenic
1002744112 5:181456714-181456736 GGCCTCAGAGCTGCTTCAGTGGG - Intergenic
1002829040 6:802202-802224 AGCCTCACACCTGTTTCTGATGG - Intergenic
1003041855 6:2695482-2695504 ATACTGACAGCTTCTCCTGTTGG - Intronic
1005023943 6:21445075-21445097 AGCCTCCGGGCTGCTTCTGTTGG + Intergenic
1006339923 6:33441280-33441302 ACCCTCAAAGCTACTGCTGTTGG - Exonic
1006444855 6:34074420-34074442 AGCCTCACAGCTGCCCTGGCAGG - Intronic
1008067021 6:47061040-47061062 AGCCTCCCTGCCGTTCCTGTGGG + Intergenic
1011739314 6:90343720-90343742 ACCATCACAGCTCCTCCTGGAGG - Intergenic
1016575366 6:145564429-145564451 AGCCTCACTGCTCATGCTGTTGG - Intronic
1017051547 6:150398289-150398311 AGCCTCTCGCCTGCTCCTCTTGG + Exonic
1018640138 6:165897815-165897837 AGCCTCACAGTAGCTACTGGAGG + Intronic
1018752477 6:166819442-166819464 AGCCCCACAGTCGCTCCTGTAGG + Intronic
1018802966 6:167237644-167237666 AGAGTCACAGCAGCTCCCGTGGG + Intergenic
1018919659 6:168162535-168162557 AGCGTCACAGCTGCATCTGAGGG - Intergenic
1019248971 6:170729943-170729965 GGCCTCAGAGCTGCTTCAGTGGG - Intergenic
1024485913 7:49919173-49919195 AGACTCACAGCTGCTCCCCAGGG - Exonic
1026155701 7:67823769-67823791 AGCCTTACAGCTTCTCTTCTTGG + Intergenic
1027250600 7:76396442-76396464 TGCCTCTCAGCTGCTACTCTGGG + Intronic
1028479251 7:91286660-91286682 AGCCCCTCTGCTGCCCCTGTTGG - Intergenic
1029746328 7:102517542-102517564 ACCCTCTCCGCTGCTCTTGTGGG + Intronic
1029764266 7:102616521-102616543 ACCCTCTCCGCTGCTCTTGTGGG + Intronic
1031687708 7:124752134-124752156 AGCCTCACTGCTCCACATGTGGG - Intronic
1031696211 7:124857933-124857955 ACCCTCTCAGATGCTGCTGTGGG + Intronic
1032117240 7:129127383-129127405 AGCCTCACAGCATCTCCTCTTGG + Intergenic
1032365119 7:131291696-131291718 ATAATCACAGCTGCTCCAGTTGG + Intronic
1034008670 7:147504234-147504256 AGCCTGAGAGCAGCTGCTGTGGG + Intronic
1034282670 7:149864783-149864805 GGCCTCACTGCTTCTGCTGTGGG - Exonic
1035308128 7:157946529-157946551 AGGCCCACAGCAGCTCCTGAGGG + Intronic
1035499075 8:77392-77414 GGCCTCAGAGCTGCTTCAGTGGG + Intronic
1035889956 8:3332442-3332464 AGCCTCACTGCAGCTCCGGTTGG - Intronic
1037124854 8:15335544-15335566 TACCTCTCAGCTGCTCCTCTGGG + Intergenic
1037673752 8:21037167-21037189 ATCCCCACAGCTGGTCCTGAAGG - Intergenic
1037770481 8:21796249-21796271 AACCTCACAGCTTCTCTTCTGGG + Intronic
1037884344 8:22588569-22588591 AACCTCACAGTTGTTCCTGGAGG - Intronic
1037884923 8:22590836-22590858 AACCTCACAGTTGTTCCTGGAGG - Intronic
1037940922 8:22950214-22950236 ACCCTCCCAGTTGCTCATGTTGG + Intronic
1041197776 8:55418296-55418318 AGCCTGACAGGAGCTCCTGATGG + Intronic
1044303346 8:90610076-90610098 AGCCTCAAAGTTGCTCCTATTGG - Intergenic
1045016419 8:98005020-98005042 AGCCCCACATCTGCTCCCTTTGG + Intronic
1045350346 8:101332513-101332535 AGCCTCAGAGCTGCCCCCTTGGG - Intergenic
1046571167 8:115968021-115968043 AGCCTCACAGCTGTTACTGATGG + Intergenic
1048254440 8:132895084-132895106 AACCTCACAGCTGCTCTGGCAGG + Intronic
1049227281 8:141461568-141461590 TGCCTCTGAGCTGCTCCTCTGGG + Intergenic
1049536176 8:143183513-143183535 CGCCTCACAGCGGGGCCTGTGGG + Intergenic
1049753380 8:144296415-144296437 CTTCTCACAGCTGCTGCTGTGGG - Intronic
1050318788 9:4429822-4429844 AGGCTCTCATCTTCTCCTGTAGG - Intergenic
1056329495 9:85510069-85510091 ACCCACTCAGCTGCTCCTGAGGG + Intergenic
1057092855 9:92275725-92275747 AGCAGCACTGCTGCTCCTGGTGG - Intronic
1058468385 9:105251654-105251676 AGCCTCACAGATTCTTCAGTTGG + Intronic
1060216628 9:121742443-121742465 AGCCACACAGCACCTACTGTGGG + Intronic
1060654676 9:125361984-125362006 GTCGTCACAGCTCCTCCTGTTGG + Intronic
1061061271 9:128251456-128251478 AGCCTGGCCTCTGCTCCTGTGGG - Intronic
1061392147 9:130323135-130323157 GCCCTCACAGCCGCTTCTGTGGG + Intronic
1061413163 9:130431867-130431889 AGCCGCACAGCTGCTGCTGCTGG + Intronic
1061903473 9:133684757-133684779 AGCCTCCCAGCTGCCATTGTGGG - Intronic
1062552705 9:137097362-137097384 AACCTCATAGCTGTTCCTGATGG + Intronic
1203609926 Un_KI270748v1:87207-87229 GGCCTCAGAGCTGCTTCAGTGGG - Intergenic
1185643260 X:1599960-1599982 AGCCTCCCTGCTCCTCCTGCAGG + Intronic
1185648164 X:1629702-1629724 AGCCTTCCAGGTGCACCTGTGGG + Intronic
1190296312 X:49029860-49029882 AGCCTCACCCCTGCCCCTGTGGG - Exonic
1190938909 X:55021274-55021296 ATCCTCATATCTGCTCCTGCAGG - Exonic
1191154202 X:57253743-57253765 TGCCTCACAGGAGCTCCTGAAGG + Intergenic
1192855138 X:75000829-75000851 TGACACACAGCTGCTGCTGTGGG + Intergenic
1192982946 X:76366755-76366777 AGCCTCACTGTTGCTGCTGCTGG - Intergenic
1194774130 X:97942510-97942532 AGCATCACACCTACTCATGTAGG - Intergenic
1195499231 X:105575130-105575152 AGACTCACAGCTTTTACTGTTGG - Intronic
1200082932 X:153588256-153588278 GTCCTCCCAGCTGGTCCTGTGGG + Exonic