ID: 1181561155

View in Genome Browser
Species Human (GRCh38)
Location 22:23701670-23701692
Sequence TACTTCCTAGGGTCTCTTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181561155_1181561158 -7 Left 1181561155 22:23701670-23701692 CCTACAAGAGACCCTAGGAAGTA No data
Right 1181561158 22:23701686-23701708 GGAAGTACCCTTCTCGACATCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181561155 Original CRISPR TACTTCCTAGGGTCTCTTGT AGG (reversed) Intergenic
No off target data available for this crispr