ID: 1181562752

View in Genome Browser
Species Human (GRCh38)
Location 22:23715224-23715246
Sequence TAGGCCCCCCAAAGGGATCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181562742_1181562752 22 Left 1181562742 22:23715179-23715201 CCACGGTGGGGCCTGACTGCGAA 0: 1
1: 0
2: 3
3: 3
4: 86
Right 1181562752 22:23715224-23715246 TAGGCCCCCCAAAGGGATCCAGG No data
1181562745_1181562752 11 Left 1181562745 22:23715190-23715212 CCTGACTGCGAAGAGAAGGGCTG 0: 1
1: 0
2: 0
3: 5
4: 148
Right 1181562752 22:23715224-23715246 TAGGCCCCCCAAAGGGATCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181562752 Original CRISPR TAGGCCCCCCAAAGGGATCC AGG Intergenic
No off target data available for this crispr