ID: 1181563098

View in Genome Browser
Species Human (GRCh38)
Location 22:23717037-23717059
Sequence TCGCCCGGAAGCCCGGCGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 52
Summary {0: 1, 1: 1, 2: 1, 3: 5, 4: 44}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181563098_1181563110 15 Left 1181563098 22:23717037-23717059 CCCACCGCCGGGCTTCCGGGCGA 0: 1
1: 1
2: 1
3: 5
4: 44
Right 1181563110 22:23717075-23717097 CGAGTCCGCGCCTCCGACAGCGG 0: 1
1: 0
2: 0
3: 0
4: 32
1181563098_1181563112 22 Left 1181563098 22:23717037-23717059 CCCACCGCCGGGCTTCCGGGCGA 0: 1
1: 1
2: 1
3: 5
4: 44
Right 1181563112 22:23717082-23717104 GCGCCTCCGACAGCGGTCGCCGG 0: 1
1: 0
2: 0
3: 7
4: 32

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181563098 Original CRISPR TCGCCCGGAAGCCCGGCGGT GGG (reversed) Intergenic
900233454 1:1574602-1574624 TCGCGCGGAAGCGCCGCGGTAGG - Exonic
905145224 1:35883054-35883076 TCGCCATGCAGCCCGGCGGGAGG - Intronic
914286077 1:146228505-146228527 TGGCGGGGAACCCCGGCGGTTGG + Intronic
914547108 1:148679258-148679280 TGGCGGGGAACCCCGGCGGTTGG + Intronic
914619399 1:149391104-149391126 TGGCGGGGAACCCCGGCGGTTGG - Intergenic
916894738 1:169151128-169151150 TCTCCTGGAAGCCCTGGGGTGGG - Intronic
921119579 1:212125127-212125149 CCGCCAGGAAGCCCAGCTGTGGG - Intergenic
1065188666 10:23192187-23192209 GGGCCCGGAGGCGCGGCGGTGGG - Intergenic
1072680044 10:97499421-97499443 TCCCCCGGCCGCCCGGCGCTGGG - Intronic
1077185479 11:1233719-1233741 GGGCTCGGAAGCCCGGGGGTGGG + Intronic
1081528370 11:43942417-43942439 TCTCCCGGAACCCCCGCGGGCGG + Exonic
1102111786 12:110370784-110370806 TCACCGGGAAGCCCTGCGCTGGG - Intergenic
1122447738 14:101781690-101781712 TCGCCCCGGAGCCCGGAGGAGGG + Intronic
1124286353 15:28403161-28403183 CCGCCCGGGAACCCGGCGCTCGG - Intergenic
1125477255 15:40055593-40055615 TTGCCCGGTAGCCCGGGGCTGGG - Intergenic
1126786174 15:52179568-52179590 TCCCCGGGACGCGCGGCGGTGGG - Intronic
1131268010 15:90930113-90930135 GACCCCGGGAGCCCGGCGGTCGG - Exonic
1136478580 16:30527406-30527428 GCCCCAGGAAGCCCGGCGGTTGG + Intronic
1139955352 16:70690538-70690560 TGGCCCAGAAGCCAGGGGGTGGG + Intronic
1144021333 17:11241612-11241634 GCGCCCGGAATCCCGGAGGCGGG + Exonic
1147672340 17:42183961-42183983 GGGCCTGGAAGCCCGGCTGTCGG - Intergenic
1153900697 18:9614708-9614730 TCGCCCGGGAGCCGCGCGGAGGG - Intronic
1160766479 19:810838-810860 TCGCCAGGGGGCCCGGCCGTGGG - Exonic
1163739773 19:19004317-19004339 TCGCCGGGAAGGCCGTCGGCAGG + Exonic
1164023402 19:21329018-21329040 ACGCCCGGGGGCCCGGCTGTCGG + Intronic
933666748 2:84970958-84970980 CCGCCCGGAGGCCCCGCGGCCGG - Intergenic
940883370 2:158968719-158968741 TCGCCCCGAGGCCCGGCCCTGGG + Exonic
1168765826 20:381197-381219 TCGCCCGGAGGCCGGGGGGCGGG + Intronic
1175803739 20:61815690-61815712 ACGCCCGGAGGCCCGGCTGAGGG + Intronic
1176103963 20:63377051-63377073 TCGCCCGGGGGCTCTGCGGTGGG - Intronic
1180726578 22:17951012-17951034 TCTCCCGGAAGACCCGTGGTAGG - Intronic
1181563098 22:23717037-23717059 TCGCCCGGAAGCCCGGCGGTGGG - Intergenic
1184521882 22:44999457-44999479 TCTCCCGGGAGCCTGGCTGTTGG - Intronic
961013047 3:123448577-123448599 TCCCCCGGAAGCCGGGCCGGGGG + Exonic
983484552 4:168318426-168318448 TGGCCCGGAAGGCCGGGCGTGGG - Intronic
1006645536 6:35512175-35512197 AGCCCCGGAAGCCCGGAGGTGGG - Exonic
1023360054 7:39406431-39406453 TCCCCCGGAAGCTCTGGGGTAGG - Intronic
1025227885 7:57179820-57179842 GCACCCGGAAGCCCGGCAGTGGG - Intergenic
1025231009 7:57203343-57203365 GCGCACGGAAGCCCGGCGGAGGG - Intergenic
1025730002 7:64100481-64100503 GCGCCCGGAAGCCCGGCGGTGGG + Intronic
1025929334 7:65981925-65981947 GCGCCCGAAAGCCCGGCGGTGGG - Intronic
1029437308 7:100570444-100570466 GCCCCCGGAAGCCCGGGGCTCGG - Intergenic
1034979525 7:155467222-155467244 CCGCCCGGAGGCCCGGCGCCGGG - Intergenic
1037985439 8:23288190-23288212 CCACCCGGGAGCCCGGGGGTCGG - Intronic
1045036129 8:98177930-98177952 TCGTGCAGAAGCCCTGCGGTGGG + Intergenic
1049264540 8:141660422-141660444 TGGCTCGGGAGCCCGGCAGTTGG + Intergenic
1057801256 9:98192662-98192684 TCCCCCTGCAGCCCGGCGGGCGG + Intergenic
1059191674 9:112333316-112333338 ACGCCCGGAAGCCCCGCCGTCGG + Intronic
1060269690 9:122131857-122131879 TCTCCAGGAAGCCCAGCGGGTGG - Intergenic
1062618087 9:137407130-137407152 CGGCCCGGACGCGCGGCGGTCGG - Intronic
1185464505 X:346529-346551 CCGCCCGGGAGCCCGGTGTTGGG - Intronic
1196425250 X:115562301-115562323 ACGTCCCGGAGCCCGGCGGTCGG - Intronic