ID: 1181565713

View in Genome Browser
Species Human (GRCh38)
Location 22:23735993-23736015
Sequence CCGTACTACTCAGGATCACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181565713_1181565718 5 Left 1181565713 22:23735993-23736015 CCATGTGATCCTGAGTAGTACGG No data
Right 1181565718 22:23736021-23736043 TAGCGATCTTTTCCTGATTTGGG No data
1181565713_1181565720 28 Left 1181565713 22:23735993-23736015 CCATGTGATCCTGAGTAGTACGG No data
Right 1181565720 22:23736044-23736066 AGCACTGTAGTAGTGCCTTCTGG No data
1181565713_1181565721 29 Left 1181565713 22:23735993-23736015 CCATGTGATCCTGAGTAGTACGG No data
Right 1181565721 22:23736045-23736067 GCACTGTAGTAGTGCCTTCTGGG No data
1181565713_1181565717 4 Left 1181565713 22:23735993-23736015 CCATGTGATCCTGAGTAGTACGG No data
Right 1181565717 22:23736020-23736042 TTAGCGATCTTTTCCTGATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181565713 Original CRISPR CCGTACTACTCAGGATCACA TGG (reversed) Intergenic
No off target data available for this crispr