ID: 1181566945

View in Genome Browser
Species Human (GRCh38)
Location 22:23744585-23744607
Sequence GCCTGAGCAGGTGGGAGCTC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1176
Summary {0: 1, 1: 0, 2: 3, 3: 48, 4: 1124}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181566930_1181566945 27 Left 1181566930 22:23744535-23744557 CCCACACTCCCGGCACTCGTAGG 0: 1
1: 0
2: 4
3: 19
4: 143
Right 1181566945 22:23744585-23744607 GCCTGAGCAGGTGGGAGCTCTGG 0: 1
1: 0
2: 3
3: 48
4: 1124
1181566939_1181566945 -2 Left 1181566939 22:23744564-23744586 CCCCGGTGTGGATGATCTGGTGC 0: 1
1: 0
2: 2
3: 26
4: 119
Right 1181566945 22:23744585-23744607 GCCTGAGCAGGTGGGAGCTCTGG 0: 1
1: 0
2: 3
3: 48
4: 1124
1181566932_1181566945 26 Left 1181566932 22:23744536-23744558 CCACACTCCCGGCACTCGTAGGG 0: 1
1: 2
2: 12
3: 65
4: 228
Right 1181566945 22:23744585-23744607 GCCTGAGCAGGTGGGAGCTCTGG 0: 1
1: 0
2: 3
3: 48
4: 1124
1181566941_1181566945 -4 Left 1181566941 22:23744566-23744588 CCGGTGTGGATGATCTGGTGCCT 0: 2
1: 1
2: 4
3: 33
4: 335
Right 1181566945 22:23744585-23744607 GCCTGAGCAGGTGGGAGCTCTGG 0: 1
1: 0
2: 3
3: 48
4: 1124
1181566934_1181566945 19 Left 1181566934 22:23744543-23744565 CCCGGCACTCGTAGGGCTTCTCC 0: 1
1: 2
2: 11
3: 36
4: 166
Right 1181566945 22:23744585-23744607 GCCTGAGCAGGTGGGAGCTCTGG 0: 1
1: 0
2: 3
3: 48
4: 1124
1181566940_1181566945 -3 Left 1181566940 22:23744565-23744587 CCCGGTGTGGATGATCTGGTGCC 0: 1
1: 0
2: 1
3: 18
4: 150
Right 1181566945 22:23744585-23744607 GCCTGAGCAGGTGGGAGCTCTGG 0: 1
1: 0
2: 3
3: 48
4: 1124
1181566935_1181566945 18 Left 1181566935 22:23744544-23744566 CCGGCACTCGTAGGGCTTCTCCC 0: 1
1: 2
2: 9
3: 33
4: 113
Right 1181566945 22:23744585-23744607 GCCTGAGCAGGTGGGAGCTCTGG 0: 1
1: 0
2: 3
3: 48
4: 1124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181566945 Original CRISPR GCCTGAGCAGGTGGGAGCTC TGG Exonic