ID: 1181568342

View in Genome Browser
Species Human (GRCh38)
Location 22:23752828-23752850
Sequence GGGCAGAAATGGGAGGCAGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 859
Summary {0: 1, 1: 1, 2: 4, 3: 86, 4: 767}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181568342 Original CRISPR GGGCAGAAATGGGAGGCAGA GGG Exonic
900565690 1:3330901-3330923 GGGCAGAAATCGGAGCCACCTGG + Intronic
900653262 1:3741788-3741810 GGGAAGAGATTGCAGGCAGATGG + Intergenic
900862888 1:5245606-5245628 GTGCAGCCCTGGGAGGCAGATGG + Intergenic
901108006 1:6772599-6772621 GGGTGGAAAAGCGAGGCAGATGG + Intergenic
901115153 1:6837513-6837535 TCTCAGAAATGGGAAGCAGATGG - Intronic
901188007 1:7387426-7387448 GGACAGAAATGGAAAACAGATGG - Intronic
901921918 1:12542821-12542843 GGGCTGAAATGAGAGCCAGGAGG - Intergenic
902292906 1:15446823-15446845 GGGCATTAATGGGAGGCAGGGGG + Intronic
902350466 1:15849679-15849701 GGGCTGGATTGGGAAGCAGATGG + Intronic
902503661 1:16926135-16926157 GGGCCCAAATGGCACGCAGAGGG + Intronic
902627569 1:17685374-17685396 AGGCAGGAATGAGAAGCAGAGGG - Intronic
903154868 1:21436549-21436571 GGGTAGAGGAGGGAGGCAGAAGG - Intergenic
903238076 1:21963688-21963710 GGGCAGCAGTGGGAGGCATCTGG + Intergenic
903317392 1:22518995-22519017 GGCAAGAAATGGGAGAGAGAGGG - Intronic
903331967 1:22601120-22601142 GGGCAATACTGGGAGGCAGCTGG - Intronic
904212391 1:28894620-28894642 GGGCAGAAATGGGAGGGATGGGG + Intronic
904259315 1:29279429-29279451 GGGCAGGATTGGCAGGCAGGTGG - Intronic
904461643 1:30684355-30684377 GAGCAGAGATGGGAGGGAAAGGG - Intergenic
904612104 1:31731424-31731446 GGGCAGGAGTGGGAGGGAGGGGG + Intronic
904757017 1:32773569-32773591 TGGCAGAACTGGAAGGCAGGAGG - Exonic
904923510 1:34027894-34027916 GGGCAGACATGGGAGTCAGGAGG + Intronic
905295481 1:36951805-36951827 GGGCAGAAATGGGGGGAACAGGG + Intronic
905500369 1:38431871-38431893 AGGCAGAGATGGGAGAGAGAGGG + Intergenic
905911466 1:41657865-41657887 AGATGGAAATGGGAGGCAGATGG + Intronic
906248615 1:44294371-44294393 GGGAAGAAATGAGAGACAGTTGG - Intronic
906360244 1:45150582-45150604 GGGCAGAAAGGGGAGCTGGAAGG - Intronic
906666060 1:47622880-47622902 GGGAGGAAATGAGATGCAGAAGG - Intergenic
907451291 1:54547501-54547523 GGGCAGAAGTCAGAGGGAGAAGG + Intronic
907732069 1:57076250-57076272 CGGCCGGAGTGGGAGGCAGAGGG + Intronic
907905107 1:58777420-58777442 GGGGACAAATGGGAAGAAGATGG - Intergenic
907933298 1:59019735-59019757 GGGCACAATTGGGAGCTAGAAGG - Intergenic
907947731 1:59151150-59151172 GGGGAGGAAGGGGAGGGAGAGGG + Intergenic
907969006 1:59362326-59362348 GAGAAGAAATAGGAGGCAGGAGG - Intronic
908499789 1:64731581-64731603 GGGTAGAAATTGGAGCCAAAAGG - Intergenic
908794507 1:67817688-67817710 GGGAAGAAAGGGAAGGCAGCAGG + Intronic
908891936 1:68858630-68858652 GGGCTGCAATGGGAATCAGAGGG + Intergenic
908926308 1:69259105-69259127 TGCCAGAAATAGGATGCAGAGGG - Intergenic
910268248 1:85364248-85364270 GTACAGAATTGGAAGGCAGAAGG - Intronic
911824842 1:102469372-102469394 GAGCAGAAGAGGAAGGCAGATGG + Intergenic
911930709 1:103899942-103899964 GGGCAGAACTATGATGCAGAGGG + Intergenic
912386604 1:109273977-109273999 TGGCAGAAAAGGCAGACAGAGGG - Intronic
912823481 1:112885612-112885634 AAGCAGAGATGGGAGGCTGAGGG - Intergenic
913041966 1:115035868-115035890 AGGCAGAAACGGCAGGTAGAAGG - Intergenic
913182509 1:116335768-116335790 GGGCAGAAAACAGAGGCAGATGG + Intergenic
913532182 1:119741232-119741254 GGGCAGAGATTGCAGGGAGAGGG + Intronic
914371720 1:147031220-147031242 AGGAAGAAATGAGAGGCAGCTGG - Intergenic
914437702 1:147674370-147674392 GGGCAGAAATGGAATGCAAGTGG + Intergenic
915982326 1:160428073-160428095 GGGCTGAAATGGGAGGGGAATGG - Exonic
916168144 1:161981445-161981467 GAGCAGAAACGGAAGGCAGAGGG - Intergenic
916208704 1:162340669-162340691 GGAAGGAAATGGGAGGCTGAAGG + Intronic
916716893 1:167454458-167454480 GGGCAGAAAGTGGAGGAACAGGG + Intronic
917654745 1:177115007-177115029 GAGGAGAAATGAGAGGTAGAAGG + Intronic
918077406 1:181181000-181181022 AGGCAGACATGGGAGAAAGAAGG - Intergenic
918308988 1:183272162-183272184 GGGCAGATTTGTGAAGCAGAAGG - Intronic
919477456 1:198046746-198046768 GGGTAGAAGTGGGTGGGAGATGG - Intergenic
919735451 1:200947517-200947539 GGGGAGACATGGTAGGCAAAGGG + Intergenic
919910250 1:202106701-202106723 GGGAAGAGATGAGAGGCAGCGGG - Intergenic
920076773 1:203342822-203342844 GGGCAGCAGTAGGAAGCAGAGGG + Intronic
920501814 1:206490352-206490374 GGGCAGAGCGGGGAGGTAGAAGG + Intronic
920620807 1:207544270-207544292 GTGCAGAAATGTGAGGCTGGGGG + Intronic
921082312 1:211751844-211751866 GGGCAGAAATGAAGGGAAGAGGG - Intronic
921835441 1:219773372-219773394 GGGTGGGAATGGGAAGCAGAAGG + Intronic
922878727 1:228962741-228962763 GGGAGGAGATGGGAGGCAGGAGG - Intergenic
922885650 1:229018531-229018553 AGGCAGAGCTGGGAGCCAGAAGG - Intergenic
922905008 1:229167645-229167667 AGGGAGAAGTGGGAGGGAGAGGG + Intergenic
923093820 1:230759332-230759354 GAGCAGGCAAGGGAGGCAGAAGG + Intronic
923095504 1:230772241-230772263 GGGCTGAAAGGGGAGGAAGAAGG - Intronic
923455483 1:234161918-234161940 GGCCATAAATGGGTGGGAGAGGG - Intronic
923827017 1:237511595-237511617 TGGTAGAAAGTGGAGGCAGAAGG - Intronic
924331563 1:242945710-242945732 GGGCTGAAGCGGGAGGCAGCTGG + Intergenic
924506117 1:244685915-244685937 GGACAGAAATGCCAGGAAGAGGG - Intronic
924612955 1:245588981-245589003 GGGGAGAAGAGGGAGTCAGAAGG - Intronic
1063059055 10:2531954-2531976 GGGCAGCAGTGGGACCCAGATGG + Intergenic
1063233395 10:4088199-4088221 TGGCAGGAATGGGAGCTAGAGGG + Intergenic
1063582849 10:7324828-7324850 AGGCAGAGAAGGGAGGCGGAGGG + Intronic
1063622310 10:7660726-7660748 GGGAAAGAATGGGAGGCAGGAGG + Intronic
1063685990 10:8237623-8237645 TGGCAGATAGGGAAGGCAGAGGG - Intergenic
1064245089 10:13661765-13661787 AGGCAGACATGGGAGGTGGAGGG + Intronic
1065059867 10:21889197-21889219 GGGCAGAAACGAGAGAGAGAGGG + Intronic
1065662593 10:28021327-28021349 AGGTAGACATGAGAGGCAGATGG - Intergenic
1065746075 10:28843614-28843636 GGGCAGAAATGGAAGAGAGAAGG - Intergenic
1065903523 10:30228628-30228650 GTGCAGAAATGGAGGGCAAATGG - Intergenic
1065921444 10:30396847-30396869 GTGCAGTGGTGGGAGGCAGACGG - Intergenic
1066011717 10:31200589-31200611 AGGCAGAAATGGAGGTCAGAAGG + Intergenic
1067144892 10:43687832-43687854 GGGCAGAAGTAGGAAGAAGAGGG + Intergenic
1067228541 10:44390931-44390953 GGCTAGGAAAGGGAGGCAGAAGG - Intergenic
1067671516 10:48327042-48327064 GGGAAGAAAAGGCATGCAGACGG - Intronic
1068120531 10:52779134-52779156 GAGCAGCAAAGGAAGGCAGAGGG + Intergenic
1068396800 10:56472570-56472592 AGGCAGAAACTGGAGGGAGATGG + Intergenic
1068596603 10:58908861-58908883 AGGCAGTAATGGTAGACAGATGG - Intergenic
1068726740 10:60311631-60311653 GAGCATAAATTAGAGGCAGAGGG - Intronic
1069881530 10:71596683-71596705 GGACAGACATGAGAAGCAGATGG + Intronic
1069884107 10:71612680-71612702 GGGCAGGAGTGGGAGGCCGGAGG + Intronic
1069890916 10:71652019-71652041 TGGCAGAAATGGGCAGAAGATGG + Intronic
1069901258 10:71707942-71707964 GGGAAGAAAGGGAAGGCTGAGGG - Intronic
1070261500 10:74860584-74860606 CCGAAGAAATGAGAGGCAGAAGG - Intronic
1070564650 10:77594471-77594493 GGACACAAATGGTAGGGAGACGG - Intronic
1070594831 10:77825239-77825261 GGGCAGGGATGGGAGGGAGCAGG + Intronic
1070741507 10:78906282-78906304 GGTCAGAAGTGGGTGGCAGAAGG - Intergenic
1071048264 10:81412037-81412059 AGGCAGAAATGGAAGACAGAAGG + Intergenic
1071563299 10:86659107-86659129 TAGCAGGAATGGGAGGCAGTGGG + Intronic
1071919769 10:90336372-90336394 GGACAGAAATGGTATCCAGAGGG + Intergenic
1072583556 10:96761420-96761442 GGGCAGAAATGGGGAGAAGATGG - Intergenic
1073338467 10:102727949-102727971 GGGGAGATATTTGAGGCAGAGGG + Intronic
1073945254 10:108742913-108742935 GGGCAGCAATGAAAGGTAGATGG + Intergenic
1074547509 10:114412764-114412786 GGTAGGAAATGGGAGGCAAAGGG - Intergenic
1074676703 10:115859480-115859502 GCCCAGAAAAGGCAGGCAGAAGG + Intronic
1074852644 10:117451090-117451112 GGGCCGCAATGGGAGGCAAAGGG + Intergenic
1075646495 10:124100220-124100242 TGGCAGAAAAGGAGGGCAGAGGG - Intergenic
1076151086 10:128162390-128162412 GGGCAGAAAAAGGAAGAAGAAGG + Intergenic
1076520144 10:131076261-131076283 GGGCAGAAGTGGGTTGCGGAGGG - Intergenic
1076520156 10:131076300-131076322 GGGCAGAACTGGGGTGCAGAGGG - Intergenic
1076738321 10:132468483-132468505 GGGAGGAGATGGGAGGCAGGGGG + Intergenic
1076826914 10:132973816-132973838 GGGCAGGCATGGCTGGCAGAGGG - Intergenic
1076930959 10:133531517-133531539 GGGGAGAAATGGGCTACAGAGGG - Intronic
1077050159 11:562909-562931 GGGCAGATATGGGGGTCACAGGG + Intronic
1077050214 11:563081-563103 GGGCAGATATGGGGGTCACAGGG + Intronic
1077284054 11:1758095-1758117 GGGCAGAAGAGGGCGGAAGAGGG + Intronic
1077341471 11:2028241-2028263 GGGCAGAAAGGGGAGCTGGACGG - Intergenic
1077357327 11:2124490-2124512 GAGCTGTAATGGGGGGCAGATGG - Intergenic
1077649055 11:3953058-3953080 AGGTAGAAATGGGACACAGAAGG + Intronic
1079002595 11:16770356-16770378 TGTCTGAAATGGAAGGCAGAGGG + Intergenic
1079238135 11:18704055-18704077 GTGAAGAAATGGGAGGGAGCAGG + Exonic
1079639717 11:22790021-22790043 GAGGAGAAAAGGGAGACAGAAGG - Intronic
1080697976 11:34619599-34619621 GGGCAGGTTAGGGAGGCAGAGGG + Intergenic
1080931675 11:36817823-36817845 GGGTTGAGATGGGAGGCACAGGG + Intergenic
1081083125 11:38768199-38768221 GGGCTGAAGTGGGAGGAAGCTGG + Intergenic
1081493214 11:43582539-43582561 GGACAGAAATGGGTAGAAGATGG + Intronic
1081989392 11:47329613-47329635 GGGAAGAATTGGGGGGCAGCCGG + Exonic
1083297600 11:61723407-61723429 GGGCAGCAGTGGGAGGCATTAGG - Intronic
1083304122 11:61753931-61753953 GGGCACAAAAGGGGGCCAGAGGG - Intronic
1083433925 11:62629968-62629990 GGGCAGAAAATGGGGACAGAAGG + Intronic
1083540756 11:63510187-63510209 GGGCCGAAACGGGTGGCAGCTGG + Intronic
1083887147 11:65578437-65578459 GGGCAGAGATGAGTGGCAGGGGG - Intronic
1083911988 11:65715327-65715349 AGGCAGAAAAGGGAGGATGAGGG + Intronic
1083944240 11:65915324-65915346 GGGCAGAAAGGGGTGCCCGAGGG + Intergenic
1084668733 11:70592696-70592718 GGGCCGAAATGGGAGGGGGCTGG - Intronic
1084702887 11:70799013-70799035 GGGCAAGAACCGGAGGCAGATGG + Intronic
1084784481 11:71434215-71434237 GGGCTGACATGGGAGGGAGAGGG + Intronic
1084891940 11:72240950-72240972 GGGCAGCTACGGGAGGCAGCAGG - Intronic
1085342982 11:75745446-75745468 GGGGACAACTGGGAGGCAAATGG + Intergenic
1085519031 11:77127408-77127430 GGGCAGCTCTGGGTGGCAGAAGG - Intergenic
1085777962 11:79383117-79383139 GGCCAGAAAGGGGACTCAGAGGG - Intronic
1086351462 11:85946016-85946038 GAGCAGAAGTGAGAGACAGAAGG + Intergenic
1086545135 11:87958957-87958979 GGGCAGAAATTGGAGGCCTGTGG - Intergenic
1086670439 11:89539939-89539961 GGGGAGACTTGGGAGGGAGAGGG - Intergenic
1087080640 11:94168022-94168044 GTGGAGAAGTGGGAGGCAGATGG + Intronic
1087098761 11:94345927-94345949 GGGCAGGAATGGGGGTCACAAGG - Intergenic
1087876004 11:103358412-103358434 AGGCAGAAATGGGGAGCACATGG - Intronic
1088363580 11:109016474-109016496 GGGTAGAAATAGGAGATAGAGGG + Intergenic
1088609808 11:111566297-111566319 GGGCAGACATGAGAGTCACAGGG + Intergenic
1089066418 11:115665551-115665573 GGGCTGAAAAGAGAGGAAGAGGG + Intergenic
1089390711 11:118099766-118099788 GGGGAGAAAGAGGAGGCAGCAGG + Intronic
1089694184 11:120206527-120206549 GGGCAGAAAAACCAGGCAGAAGG - Intergenic
1089705159 11:120272436-120272458 GGGAGGAAATGGGAGGTAGAAGG + Intronic
1089749451 11:120640027-120640049 GGCAACAAATGGGAAGCAGAGGG - Intronic
1090440323 11:126719967-126719989 GAGCTGAAATCAGAGGCAGAGGG - Intronic
1090546825 11:127774674-127774696 GGGCAGGAATGGGGGTCACAAGG + Intergenic
1090645135 11:128761108-128761130 GGGAAGAAGTGGGAGGGAGGGGG - Intronic
1091188033 11:133664201-133664223 GGGCAGGAATGGGAGGAAACCGG + Intergenic
1091230351 11:133984186-133984208 GGGCAGCACTGGGCGGCCGAGGG - Intergenic
1091332751 11:134743516-134743538 AGGCAGAAAGGGGAGGCTGTGGG - Intergenic
1202824457 11_KI270721v1_random:83430-83452 GGGCAGAAAGGGGAGCTGGACGG - Intergenic
1091585563 12:1814286-1814308 GGGCAGAAATGGGGGGAGCAGGG + Intronic
1091850639 12:3694088-3694110 GGGCTGAAAGGGGAGGAAGCTGG - Intronic
1092120750 12:6042173-6042195 GAGCAGGAATGGGGTGCAGAGGG - Intronic
1092168058 12:6355126-6355148 GAGCAGGAATGAGGGGCAGAGGG - Intronic
1092229598 12:6769212-6769234 GGGCAGGCAAGGGAGGCGGAGGG + Intronic
1092233190 12:6789249-6789271 GGAAAGAAGTGGGAGGCAGTTGG - Intronic
1092471095 12:8781967-8781989 GGACAGAAATGAAAGGCATATGG + Intronic
1093249678 12:16786728-16786750 TGGCAGAAATTGGATGCAGCAGG - Intergenic
1095967720 12:47880095-47880117 TGGGAGAACTGGGAGGCAGTAGG - Intronic
1096017822 12:48294582-48294604 GGCCAGACATTGGAGTCAGAAGG - Intergenic
1096109381 12:49020125-49020147 GGGCAGAAAGGGGAAGGAAAGGG + Exonic
1096556614 12:52407875-52407897 AGGCCACAATGGGAGGCAGAAGG + Intergenic
1096737175 12:53664803-53664825 GGGAAGAGACTGGAGGCAGAAGG + Intronic
1096776703 12:53968721-53968743 GGGCAGAATGTGCAGGCAGAAGG + Intergenic
1096777758 12:53974329-53974351 GGGGAGAAAGGGGAGGGCGAGGG + Intronic
1096849449 12:54426398-54426420 GGGGAGAAAAAGGAGGGAGAAGG + Intergenic
1097144114 12:56928204-56928226 GGGAAGCAATGGGAGGTAGCTGG - Intronic
1098169627 12:67733750-67733772 GAGAAGAAATGGGAGGGAGGAGG - Intergenic
1098554208 12:71800199-71800221 AAGCAGGAATGGGAGGGAGAAGG - Exonic
1099222853 12:79934988-79935010 GGGAAGAGAGGGGAGGCAGGGGG + Exonic
1099530600 12:83775474-83775496 GGCTAGAAAGGGTAGGCAGATGG + Intergenic
1100103427 12:91138632-91138654 AGGCATAAATGGGAGACAGAGGG + Intergenic
1100523749 12:95400822-95400844 TGGCAGAAAGAGAAGGCAGAGGG - Intergenic
1100718375 12:97329366-97329388 GGGGAGAAATGGAAGGAAAAGGG + Intergenic
1100864924 12:98847254-98847276 GGGCAGAAATGGAAAGGTGATGG - Intronic
1100959776 12:99949690-99949712 GGGCAAAAGAGGGTGGCAGAGGG - Intronic
1102230262 12:111257292-111257314 AGGAAGAAGTGGGAGGAAGAGGG - Intronic
1103239065 12:119398108-119398130 GGGGAGGAAGGGGTGGCAGAGGG + Intronic
1103297825 12:119903305-119903327 GGAGAAAAACGGGAGGCAGATGG - Intergenic
1103743291 12:123105806-123105828 AGGCAGAAACGAGAGGAAGAAGG + Intronic
1103900854 12:124303005-124303027 GTGCAGGAGTGGGAGGCAGGAGG - Intronic
1104013777 12:124949396-124949418 GAGCAGAAGCAGGAGGCAGAGGG + Intronic
1104496048 12:129240252-129240274 CGGCATAAAAGTGAGGCAGAGGG - Intronic
1104861733 12:131927682-131927704 AGGCAGGAAGGGGAGGCAGGAGG - Intergenic
1105476123 13:20729646-20729668 GGGGAGAAATTGGGAGCAGATGG - Intronic
1106436225 13:29725162-29725184 GGGGAGAAATGGGAGACACATGG + Intergenic
1107797119 13:44064353-44064375 GTGCAGAAATTGGAGCCAGGGGG + Intergenic
1108236549 13:48413928-48413950 GGGAAGAGCTGGGAGGAAGAAGG - Intronic
1108839252 13:54592683-54592705 GGGCTGAAAGGGGAGGAAGCTGG + Intergenic
1108953294 13:56117996-56118018 GGGCAGGAATGGGGGTCACAAGG + Intergenic
1109065168 13:57678227-57678249 GGTCAGAGATCGGAGACAGAAGG + Intronic
1109365263 13:61347057-61347079 GGGCAAAACTGGGATTCAGAAGG - Intergenic
1109724251 13:66318622-66318644 GGGAACAAAATGGAGGCAGAGGG + Intronic
1110191842 13:72739437-72739459 GTGCAGAAATGTGAGGCCTATGG - Intronic
1111795229 13:92910714-92910736 AGGGAGAAAGGGGAGGCAGAGGG + Intergenic
1113085975 13:106569958-106569980 GGGAAGGGATGGGAGGCAAAAGG + Intergenic
1114271711 14:21104132-21104154 GGGTAGATAGGGCAGGCAGAGGG + Intronic
1114409594 14:22488264-22488286 AGACAGAAATGAGATGCAGATGG + Intergenic
1114664254 14:24368872-24368894 TGGCCGCAATGAGAGGCAGATGG + Intronic
1116375839 14:44199564-44199586 GGGAAGAAAGGGAAGACAGAAGG + Intergenic
1116490073 14:45495093-45495115 GGGCAGGAATGGGGGTCACAAGG + Intergenic
1116580754 14:46637914-46637936 GGGCTGAAGTGGGAGGAAGCTGG - Intergenic
1117517187 14:56513459-56513481 GTGCCTTAATGGGAGGCAGAAGG - Intronic
1117638624 14:57774198-57774220 GGGCTGAAAGGGGAGGAAGCTGG + Intronic
1119159462 14:72441185-72441207 GGGCTGGAATGAGAGGCTGAAGG + Intronic
1119513395 14:75229286-75229308 GGGCAGAAGAGCCAGGCAGATGG + Intergenic
1119722575 14:76901153-76901175 GGGAAGAAGCAGGAGGCAGAGGG + Intergenic
1120539890 14:85738377-85738399 GGGCAGGAGTGGGAGTCACAAGG + Intergenic
1121103527 14:91265392-91265414 GGGCAGAAATGAGAGGGAAATGG + Intergenic
1121121650 14:91379591-91379613 GAGCAGAAGTGGGACGCTGACGG + Intronic
1121277179 14:92676450-92676472 GGGAAGAAGAAGGAGGCAGAGGG - Intronic
1121328481 14:93035254-93035276 GGGCAGACATGGTTGGCAGTTGG + Intronic
1121822477 14:96982644-96982666 GGGAAAGAATGGGAGCCAGAGGG - Intergenic
1122237012 14:100337008-100337030 GGGCAGGAGTGGGTGGCAGAAGG + Intronic
1122268879 14:100559388-100559410 GGGCAGGACTGGCAGACAGATGG + Intronic
1122651958 14:103231097-103231119 GGGCAGTAATCAGAGGAAGACGG + Intergenic
1122652326 14:103232510-103232532 GGGCAGGGCTGGGAGGCAGGAGG + Intergenic
1122794015 14:104196742-104196764 AGGCAGAAATGGGGGGTGGATGG - Intergenic
1124210904 15:27764234-27764256 GGGGAGAAAGGAGAGGCAGGAGG + Intronic
1124381731 15:29172997-29173019 AGGCAGAAATAGGCTGCAGAGGG - Intronic
1124643026 15:31409524-31409546 AGGAAGAAAAGGGAGGAAGAAGG + Intronic
1125050709 15:35295227-35295249 GGTCAGAGATGGGTAGCAGATGG - Intronic
1125242436 15:37591261-37591283 TGGAAGAAATGGGAGGGACAGGG - Intergenic
1125289704 15:38132092-38132114 GGGTAGAAATTGTAGGCAGGGGG + Intergenic
1126354764 15:47783509-47783531 GGTCAGAAATGGGGGCCAGCTGG + Intergenic
1127089915 15:55457020-55457042 AAGCAGAAATTGGTGGCAGAGGG + Intronic
1127597318 15:60498747-60498769 GGGCAGGAATGGGAAGTGGAAGG - Intronic
1127960086 15:63884447-63884469 GGGCACAATTGTGAGGCAGACGG + Intergenic
1128258134 15:66213048-66213070 GGGCAGAAAGGAGAGGCCGCAGG + Intronic
1128366969 15:67011207-67011229 GAGCTGCCATGGGAGGCAGAGGG + Intergenic
1128693034 15:69739737-69739759 GAGAAGGAAGGGGAGGCAGAAGG + Intergenic
1129194461 15:73955797-73955819 GGGAGGAAATGGGAGGTAGAAGG + Intergenic
1129463631 15:75712142-75712164 GGGCAGAGCTGGGGGGCAGCTGG + Intronic
1129721257 15:77879260-77879282 GGGCAGAGCTGGGGGGCAGCTGG - Intergenic
1129848370 15:78778350-78778372 GGGCAGAAGCGGGTGCCAGAAGG - Intronic
1129966050 15:79736662-79736684 GTGCATAAGAGGGAGGCAGAAGG + Intergenic
1130104016 15:80915558-80915580 GGTAAGAGATGGGAGGGAGAGGG + Intronic
1130170100 15:81502603-81502625 GGACAGAGCTGGGAGCCAGAGGG - Intergenic
1130521019 15:84660585-84660607 GGAAAAAAATGGGAGGCACAGGG + Intergenic
1130710826 15:86279397-86279419 CGGCACAATTGGGAGGCAGATGG + Intronic
1130991151 15:88876905-88876927 GGGTGGGAGTGGGAGGCAGAGGG + Intergenic
1131060832 15:89403684-89403706 GGTCAGGAATGGGATGAAGAAGG - Intergenic
1131347529 15:91664621-91664643 GGGGAGGAGTGGGAGGAAGAGGG - Intergenic
1131652545 15:94416878-94416900 TGGTAGAAATGGGAGGGAGAAGG - Intronic
1131787224 15:95926164-95926186 GAGTAGAAATGGGAGGAGGAAGG - Intergenic
1132121709 15:99181677-99181699 GGGCAGAGATGGGAGAGGGAAGG - Intronic
1132283390 15:100640594-100640616 GGGTAGAAATTGGAGGTGGAGGG - Intronic
1133392690 16:5422553-5422575 GGGAAGAAAGGGGAGGAGGAGGG + Intergenic
1133476084 16:6123491-6123513 GGGCTGAAATGTGAGGAATAAGG + Intronic
1133569385 16:7026117-7026139 GGGTGGAAATGGCAGCCAGAAGG + Intronic
1134225940 16:12390225-12390247 GAGCAGAGATGGGAGGCAAGAGG - Intronic
1134449334 16:14354049-14354071 GGGCAGAGAGGGGAGGGGGAAGG + Intergenic
1134804300 16:17111758-17111780 GGGCACAAGTGGGAGGAAGGAGG + Intronic
1135003810 16:18801166-18801188 AGGAGGAAGTGGGAGGCAGAGGG - Intronic
1135521556 16:23182417-23182439 GGGCAGTAATAGGGGGCAGCAGG + Intergenic
1136842102 16:33547927-33547949 GGGCAGAAAAGGCAGGCCCATGG + Intergenic
1136862211 16:33711024-33711046 GGGCAGAAAAGGCAGGCCCATGG - Intergenic
1138242091 16:55435538-55435560 AGGCAGAAAGGCGAGGCTGATGG - Intronic
1138574271 16:57897547-57897569 GGGCAGAGAAGGGAGGAAGGAGG + Intronic
1138729923 16:59183271-59183293 GGGCTGAAGTGGGAGGAAGCTGG - Intergenic
1139019402 16:62728660-62728682 GAGAAGAAATGGGAGGGAGAGGG + Intergenic
1139489126 16:67277331-67277353 GGCAAGAAATGGGAGGCTGAGGG + Intergenic
1141397683 16:83719363-83719385 GTGCAGAAATTGGAGACAGTGGG - Intronic
1141757788 16:86004040-86004062 GGGGAGAGAGAGGAGGCAGAAGG + Intergenic
1141955259 16:87366544-87366566 GGGCAGAGCTGGGAGGCAAAGGG + Intronic
1142286330 16:89173007-89173029 GGGCTGAAATTGGAGCCAGCTGG - Intronic
1203123706 16_KI270728v1_random:1559207-1559229 GGGCAGAAAAGGCAGGCCCATGG - Intergenic
1203152267 16_KI270728v1_random:1848224-1848246 GGGCAGAAAAGGCAGGCCCATGG + Intergenic
1142493661 17:294518-294540 GTGCAGAAATGGACGGCAGAGGG + Intronic
1142493815 17:295507-295529 CTGCAGAAATGGAAAGCAGAGGG + Intronic
1142493848 17:295725-295747 CTGCAGAAATGGAAAGCAGAGGG + Intronic
1142493881 17:295943-295965 CTGCAGAAATGGAAAGCAGAGGG + Intronic
1142668893 17:1478326-1478348 GGGCAGGAATGAGAGGCTGGAGG + Intronic
1143090698 17:4447755-4447777 GGGCAGGACTGTGTGGCAGATGG + Intronic
1143108485 17:4541063-4541085 GGGCAGGGCTGGGAGGCAGCTGG - Intronic
1143188127 17:5022720-5022742 GAGGAGAGAAGGGAGGCAGAAGG - Intronic
1143661069 17:8324933-8324955 GGACAGAAGAGGGAGGCTGATGG + Intergenic
1143861503 17:9894530-9894552 GGGCAGAAATGGGAGTGAAGTGG + Intergenic
1144454706 17:15409146-15409168 GGGCTGAAAGGGGATGGAGAAGG + Intergenic
1144553276 17:16260100-16260122 GAGCACAAGTGGGAGGCCGAGGG + Intronic
1145866698 17:28246510-28246532 GGCCAGAGATGGGAGGGGGACGG - Intergenic
1145880762 17:28351126-28351148 GGACAGTAATGGGAGACAGGAGG - Intronic
1146007609 17:29170534-29170556 GGAGAGGAATGGGAGGCAGATGG - Intronic
1146087903 17:29847355-29847377 GGGCTGAAAGGTGAAGCAGAGGG + Intronic
1146255898 17:31391559-31391581 CGGCGAAAATGGGAGGGAGAGGG - Intergenic
1147248640 17:39139270-39139292 GGGCAGAAATGGGGTGGGGAAGG + Intronic
1147381852 17:40061007-40061029 AGGCAGAACTAGGAGGCAGTGGG - Intronic
1147556622 17:41483555-41483577 GGGCAGAAAAAGGAGGAAGGAGG - Intergenic
1147578012 17:41613638-41613660 GGGCAGGATGGGGAGGCTGAGGG - Intronic
1147892475 17:43727083-43727105 GGGCAGAAATAGAAGGCAAGAGG + Intergenic
1147914046 17:43876271-43876293 TGGAAGAACTGGGAGGCACAAGG + Intronic
1147933516 17:43997695-43997717 GGGCAAAAATGGAAGCAAGAAGG + Intronic
1148665509 17:49371588-49371610 GGGCTGGAATGGGAGGGGGAGGG + Intronic
1148733313 17:49851018-49851040 GGGCAGAAAGGAGAGGGCGACGG + Intergenic
1148894029 17:50829673-50829695 GGGAAGTAAATGGAGGCAGAAGG + Intergenic
1148985042 17:51613511-51613533 GGGCAGAGAGGGGAGAGAGAGGG - Intergenic
1149603816 17:57910977-57910999 GGGAGAAAATGGGAGGGAGACGG - Intronic
1150380182 17:64713928-64713950 AGGCAGAAAAGGGAGGCAAAAGG + Intergenic
1150533901 17:66014753-66014775 GGGCTGAAAGGGGAGGAAGCTGG - Intronic
1150776546 17:68086238-68086260 AGGCAGAAAAGGGAGGCAAAAGG - Intergenic
1150918479 17:69459870-69459892 AGGGAGAAAGGGAAGGCAGAAGG - Intronic
1151533987 17:74727061-74727083 GGTCTGAACTGGGAGGGAGAAGG - Intronic
1151772060 17:76170175-76170197 GGGCAGAATGGAGAGGCAGCTGG + Intronic
1152024167 17:77797927-77797949 GGGGAGGAAGGGGAGGCAGAGGG - Intergenic
1152318976 17:79597406-79597428 GGGCAGAAAGAGGAGGCACAGGG + Intergenic
1153095957 18:1403565-1403587 AGGAACAAATGGGAGGAAGATGG + Intergenic
1153225778 18:2898467-2898489 GAGCAGGAAGGGAAGGCAGAGGG + Intronic
1153748814 18:8208871-8208893 GGAAAGAAATTCGAGGCAGAGGG + Intronic
1155273878 18:24167331-24167353 GGGCAGAATTTGGAGGCCGTGGG + Exonic
1155496557 18:26448448-26448470 GGGCAATGGTGGGAGGCAGATGG - Intergenic
1155599990 18:27534103-27534125 GGGCAGAAATGTAAGGGATAAGG - Intergenic
1155719091 18:28988173-28988195 GGACAGACATGGGAGACAGCTGG - Intergenic
1155845165 18:30696066-30696088 GGGCTGAAAGGGGAGGAAGCTGG - Intergenic
1156110631 18:33722099-33722121 GGAGAGAAATGGGAGACAGCTGG - Intronic
1156422269 18:36967713-36967735 GGGCTGAAAGGGGAGGAAGCTGG + Intronic
1156526370 18:37771415-37771437 GGGCAGAGATAGGAGGCAGAAGG - Intergenic
1156608148 18:38693352-38693374 GGGCAGACAAGGGAAGCAGAAGG - Intergenic
1157019159 18:43758235-43758257 GGTGGGAAATGAGAGGCAGAAGG + Intergenic
1157051953 18:44176514-44176536 GAGCAGGAATGGAAGGTAGACGG + Intergenic
1157453258 18:47803708-47803730 GCACAGAAATGGGTGGCAGCTGG - Intergenic
1157505379 18:48222584-48222606 GGGCAGATTTGGGAGGCAGCAGG - Intronic
1158321750 18:56270825-56270847 GGGAAGAAAGAGCAGGCAGATGG + Intergenic
1158411905 18:57213454-57213476 GGGCAGAGATGGGAGGAGGCAGG + Intergenic
1158463815 18:57671294-57671316 GGGCAGAACTGGGACCCAGGTGG + Intronic
1158753238 18:60290949-60290971 TGGCAGAACTGAGAGGCAGGTGG - Intergenic
1159029253 18:63214134-63214156 CGGGAGAAATGGAAGGGAGAGGG + Intronic
1160021245 18:75183604-75183626 GGGCACAAAGGAGGGGCAGAGGG - Intergenic
1160625135 18:80199002-80199024 GGGGAGAATTGGGAGGGAGGGGG - Intronic
1160855130 19:1213842-1213864 GAGCAGGACTGGGAGGCACATGG - Intronic
1161063048 19:2224705-2224727 GGGAGGCACTGGGAGGCAGAAGG - Intronic
1162351089 19:10150190-10150212 GAGCAGAAGTGGGAGGGACATGG - Intronic
1162476719 19:10904850-10904872 GGGCACCAAGGGGAGGCAGCAGG + Intronic
1162497802 19:11033168-11033190 GGGCAGAATTGTCAGGCCGAGGG + Intronic
1163048957 19:14666781-14666803 GGAAAGAAATGAGTGGCAGAGGG - Intronic
1164606871 19:29605961-29605983 GGGCGGAAATGGGACGGGGACGG - Exonic
1164694362 19:30232420-30232442 GGGGAGAAAGGCGGGGCAGAAGG - Intronic
1164720990 19:30431376-30431398 GCGCAGAAATTGCAGGCAGCAGG + Intronic
1164912434 19:32023685-32023707 GGGCAGAGGTGGGACCCAGAGGG + Intergenic
1165064475 19:33221015-33221037 GGGAAGAAGTGGGAGGAGGAAGG - Intronic
1165393143 19:35549727-35549749 CGGCAGAGATGGGAGGTAGGGGG + Intergenic
1165846484 19:38821174-38821196 GGGCTGAAGTGGGAGGATGAGGG + Intronic
1165906914 19:39199955-39199977 GGGCTGGAATTGGAGGCACAGGG - Intronic
1165957171 19:39508191-39508213 GGGGAGGCAGGGGAGGCAGAGGG + Exonic
1166039830 19:40195113-40195135 AGGCAGAGATGGGAGGAAGTAGG + Intronic
1166301552 19:41914328-41914350 AGACAGAAATGGAAGGGAGATGG - Intronic
1166316502 19:41992550-41992572 GGACAGGAAGAGGAGGCAGAGGG - Intronic
1166566222 19:43767177-43767199 GGGCAGAAGTGGGAGACAGGGGG + Intronic
1167056271 19:47113039-47113061 GGGCAGAGAAGGGAGACAGTCGG - Intronic
1167272265 19:48512000-48512022 GGGAGGAAATGGGAGGGGGAGGG + Intronic
1167365584 19:49053519-49053541 TGGCTGGGATGGGAGGCAGATGG + Intergenic
1167442157 19:49514568-49514590 GGGCTGCAGTGGGAGGCTGATGG - Intronic
1167622845 19:50568584-50568606 GGGAAGAAAGGAGAGGGAGACGG + Intergenic
1167699596 19:51034676-51034698 GGGCAGAGGTGGGGGGCACAGGG - Intronic
1167707298 19:51089142-51089164 GGGGAGAAAAGGAAGGCAGATGG - Intergenic
1167716648 19:51146615-51146637 GGGCAAGAATGGGAGGGAGGAGG - Intronic
1167982633 19:53287785-53287807 GGGGAGAAATGGGAGAAAGTTGG - Intergenic
1168207276 19:54860287-54860309 GGGCAGAAAATGTAGGCACAAGG + Intronic
925190270 2:1876653-1876675 GGGCTGGGATGGGAGGCAGCAGG - Intronic
925565810 2:5253041-5253063 GGGCAGAGCTGGGAGGGAGTGGG + Intergenic
925855184 2:8122661-8122683 CAGCTGGAATGGGAGGCAGAGGG + Intergenic
926113615 2:10197461-10197483 AGGCAGCACTGGGAAGCAGAAGG + Intronic
926129267 2:10290726-10290748 AGGCGGGAATGGGAGGCAGTGGG - Intergenic
926148331 2:10410682-10410704 GGTAAGAAATGGGAGGCCCAGGG - Intronic
926364625 2:12121816-12121838 GGGTAGACTTGGGAGGGAGATGG - Intergenic
926370931 2:12177985-12178007 AGGCCCAAATGGGAGGCAGCAGG + Intergenic
926473019 2:13285065-13285087 CAGCAGAGAGGGGAGGCAGAGGG + Intergenic
926794253 2:16606032-16606054 GGGTGGAAATTGGAGTCAGAAGG - Intronic
928490374 2:31777662-31777684 GGGCTGAAAGGGGAGGAAGCTGG + Intergenic
928660657 2:33499115-33499137 GGTCAGAAATGGGAGGGGGTTGG - Intronic
929320424 2:40537374-40537396 GCCAAGACATGGGAGGCAGAAGG + Intronic
929544861 2:42849155-42849177 GGGCAGGGAAGGGAGGCAGTGGG + Intergenic
929592197 2:43154665-43154687 AGGCAGAAATGGGTGGATGAAGG + Intergenic
929961331 2:46498427-46498449 TGGGAGAAAGGGGAGGCAGGAGG - Intronic
931426566 2:62177175-62177197 TGAGAGAATTGGGAGGCAGAGGG + Intergenic
931729002 2:65136590-65136612 TGGCAGAAATGGGAGTGAGGAGG + Intergenic
932090491 2:68801604-68801626 TGGGAGGAATGGGAGGCAGCAGG + Intronic
932573379 2:72949996-72950018 GGACAGGCCTGGGAGGCAGATGG + Intronic
932574264 2:72954254-72954276 GGGCTGACATGGGAGGCTCAGGG + Intronic
933164167 2:79056876-79056898 GGGCAGGAATGGGGGTCACAAGG - Intergenic
933294524 2:80473964-80473986 GGGCAGGAATGTAAGACAGATGG - Intronic
933539517 2:83620414-83620436 TGGCAGAAATGGGAGTGACATGG - Intergenic
934216827 2:90038782-90038804 GTGCAGAGAGGGGAGGCAGATGG + Intergenic
934790842 2:97058789-97058811 AGGCAGACATGTGAGGTAGAGGG + Intergenic
935409370 2:102743419-102743441 GCTCAGGAATGGGAGGCACAGGG + Intronic
935543884 2:104380063-104380085 GGGCAGAAATAGCAGGCAGGAGG - Intergenic
935596666 2:104883935-104883957 GGCAGGAAATGGGAGGAAGACGG + Intergenic
936019509 2:108984196-108984218 GGGCAGGAAGGGCAGGCAGCAGG - Intronic
936143260 2:109959552-109959574 GCGCACAAATGGGAGGGAGGAGG + Intergenic
936179948 2:110257518-110257540 GCGCACAAATGGGAGGGAGGAGG + Intergenic
936201427 2:110411915-110411937 GCGCACAAATGGGAGGGAGGAGG - Intronic
937078631 2:119124956-119124978 GGGGAGGATGGGGAGGCAGAGGG + Intergenic
937230909 2:120397627-120397649 GGGCAGGCATGGGGCGCAGAGGG + Intergenic
937273412 2:120669689-120669711 TGGCAGGAAGGGGAGGCACAGGG - Intergenic
937900547 2:127016136-127016158 AGGCCGAGGTGGGAGGCAGAGGG + Intergenic
937920039 2:127122396-127122418 GAGCAGAAATAGGAGGGAGCTGG - Intergenic
938670951 2:133586321-133586343 GGCCAGGAATCGGAAGCAGAAGG - Intergenic
939179001 2:138782135-138782157 AAGCAGAAATGGGATGCAGCTGG - Intergenic
940169338 2:150810402-150810424 GGAAAGAAATGGGGGGCAGGGGG + Intergenic
940637536 2:156317815-156317837 GGGCAGAAGCAGGTGGCAGACGG - Intergenic
941054862 2:160776459-160776481 GGGCTGAAGTGGGAGGAAGCTGG + Intergenic
941455310 2:165707769-165707791 GGGCAGGAGTGGGAGTCACAAGG + Intergenic
942007038 2:171713855-171713877 AGGAAGCAATGGGAGGCAGGAGG - Intronic
942440280 2:176027849-176027871 AGGCAGAAAGGGAAGCCAGAAGG + Intergenic
942609446 2:177727763-177727785 TGTCTGAAATGGGAGGGAGAGGG + Exonic
942651020 2:178168015-178168037 GGGGAGGAATGGCAGGAAGATGG + Intergenic
942671964 2:178385463-178385485 AGGCAGAAATGGGTGGATGATGG - Exonic
943157289 2:184199026-184199048 GGGCAGGAGTGGGAGTCACAAGG - Intergenic
943300322 2:186190427-186190449 GGGAAGATATAGGAGGCAGATGG - Intergenic
943479216 2:188396691-188396713 GGCCAGAAATGGGAGGCAAGTGG - Intronic
943606973 2:189987501-189987523 AGGCAGATTTGGGAGGCTGAGGG - Intronic
945058320 2:205887334-205887356 GGGTAGGAATGGCAGGCAGGTGG - Intergenic
945200419 2:207275543-207275565 GGCCAGCAAAGGGAGGCAGGTGG - Intergenic
945264964 2:207881893-207881915 AGGCAAAAGAGGGAGGCAGAGGG - Intronic
945682297 2:212928592-212928614 AGGCAGAAAAGGGAAGCAGATGG + Intergenic
945703650 2:213202217-213202239 GGGCAGACACTGGAGCCAGATGG - Intergenic
946055252 2:216895538-216895560 GTGCAGAGATGGGAGGTTGAAGG + Intergenic
946242157 2:218362987-218363009 GAGTAGAAAAGGGAGGCAGGTGG + Intronic
946808067 2:223492164-223492186 ATGCAGAAGAGGGAGGCAGAGGG - Intergenic
946926667 2:224633259-224633281 GTGTAGAAATGGGAGGCCTAGGG + Intergenic
947239918 2:227983450-227983472 GGAGACAGATGGGAGGCAGATGG + Intronic
947281567 2:228460950-228460972 GGGCTGAAAGGGGAGGAAGCTGG - Intergenic
947547820 2:231023687-231023709 GGTGACACATGGGAGGCAGAGGG - Intronic
947876839 2:233473411-233473433 TGGCTGACATGGGAGGCAGAGGG + Intergenic
947974909 2:234357455-234357477 GGCCAGAAATATGAGGCTGAGGG - Intergenic
948234541 2:236378762-236378784 GGGCAGATTTGGGGGGCAGAGGG - Intronic
948836524 2:240628687-240628709 GGGCAGAGGGAGGAGGCAGAGGG + Intronic
1169355372 20:4900863-4900885 GGGCAGGAATGGGAAGCTGCTGG - Intronic
1170821075 20:19756910-19756932 GGGAAGAAGTGGGAGACAGAGGG - Intergenic
1170905385 20:20511509-20511531 GGGTAGTAATGGGATGCTGATGG - Intronic
1170976048 20:21165666-21165688 GGGCAGGACTGGGAGTCTGATGG + Intronic
1171558627 20:26099665-26099687 GGGAAGGACTGTGAGGCAGAGGG - Intergenic
1172257455 20:33531621-33531643 AGGCATAAATGAGAGGCATATGG + Intronic
1172448429 20:35005138-35005160 GGGCAGAAAAAGGAAGCAAACGG + Intronic
1172613282 20:36267069-36267091 GTGAAGCCATGGGAGGCAGATGG + Intronic
1172771064 20:37382874-37382896 ATGGGGAAATGGGAGGCAGAGGG + Intronic
1172932869 20:38598575-38598597 GGGCAGGAGTGGGAGTCACAAGG + Intergenic
1173464692 20:43271602-43271624 GGGGAGACATTGGTGGCAGAAGG + Intergenic
1173485812 20:43440240-43440262 GGGCAGAAATGGGAAGAACTGGG - Intergenic
1173627054 20:44480763-44480785 AGGCAGAAATGTGTGGCTGAAGG - Intronic
1173819789 20:46012592-46012614 GGGCAGGGATGGGAGGAGGAGGG + Intronic
1173844309 20:46178360-46178382 GGGCAGAATTTGGAGGCATCTGG - Intronic
1174300517 20:49578905-49578927 GGTCAGAAATCACAGGCAGAAGG - Intergenic
1174705056 20:52646960-52646982 GTGCTGAAATGGGAAGTAGAAGG - Intergenic
1175116944 20:56689408-56689430 GGGCAGAAGTGGGAGGGAGGAGG + Intergenic
1175130088 20:56782338-56782360 GGGAAGAAAAGGAAGGAAGAAGG + Intergenic
1175333766 20:58181785-58181807 TGTCAGAACAGGGAGGCAGAGGG - Intergenic
1175656413 20:60774987-60775009 TTGCAGAAATTGGAGGCAGAAGG + Intergenic
1175660416 20:60807920-60807942 AGGCAGAAATGAGACCCAGATGG + Intergenic
1175823701 20:61925157-61925179 GGGCAGAGACGGCAGGAAGAAGG + Intronic
1176084683 20:63290572-63290594 GGGAAGAGACGGGTGGCAGAAGG - Intergenic
1176152974 20:63602472-63602494 TGACAGAATTGAGAGGCAGATGG - Intronic
1176870633 21:14080809-14080831 GGACTGAAATGGGAGGGAGTGGG + Intergenic
1177119671 21:17124352-17124374 GGGGGGAAATGAGAGGAAGACGG - Intergenic
1177993454 21:28066716-28066738 GGGCAGAAGTGGCAGCCAGAAGG + Intergenic
1178051492 21:28752731-28752753 GGGCAGAAATGAGAGAGAAAGGG + Intergenic
1178195994 21:30345828-30345850 AGGCAGAAATGGGCTGCAAATGG + Intergenic
1179020749 21:37638598-37638620 GGGTGGAAATGGTAGGCAGAAGG - Intronic
1179051923 21:37895749-37895771 GGGCAGGAGAGGGAGGGAGATGG - Intronic
1179417278 21:41208745-41208767 AGGCAGAGATGGGGAGCAGAGGG - Intronic
1179479224 21:41667068-41667090 AGGCAGAAAGGGGAAGCACATGG + Intergenic
1179552386 21:42151341-42151363 GGGCAGGTATGGGAGGCACCCGG - Intergenic
1180069126 21:45427415-45427437 AGGCAGACATGGGAGGCTGGTGG - Intronic
1180153967 21:45968667-45968689 GGGCAGAAAGGAGGGGGAGACGG + Intergenic
1180186924 21:46144734-46144756 GGGCAGAAAAGAGAGAGAGAGGG - Intronic
1180613856 22:17114800-17114822 GTGCAGATGTGGGAGGAAGAAGG + Exonic
1180875303 22:19172259-19172281 GAGCAGAACTTGGGGGCAGAGGG + Intergenic
1180926747 22:19560231-19560253 GGGCAGCAACTGGAGGCAGGGGG + Intergenic
1181312404 22:21952503-21952525 GGGCAGAACTGGGGGGCAGGCGG - Intronic
1181471929 22:23145819-23145841 GGACAGAAAAAGGAGACAGAGGG + Intronic
1181534384 22:23534113-23534135 GGGCAGGACAGGGAGGAAGAAGG + Intergenic
1181568342 22:23752828-23752850 GGGCAGAAATGGGAGGCAGAGGG + Exonic
1181758792 22:25043536-25043558 GGGAAGAAATCTGAGGCATAAGG + Intronic
1183302634 22:37065822-37065844 AGAGAGAATTGGGAGGCAGAAGG + Exonic
1183367243 22:37413206-37413228 TGGCAGAAATGGGGGTGAGAGGG + Intronic
1183506444 22:38211756-38211778 GTGCAGAAATGGAAAGCACATGG - Intronic
1183775336 22:39960400-39960422 GGGCTAGAAGGGGAGGCAGATGG - Intronic
1184078544 22:42200708-42200730 TGGTAGAAACGGGAGTCAGAAGG - Intronic
1184387134 22:44182632-44182654 GGGCTGAAAAGGGAGGAAGAGGG + Intronic
1184948162 22:47818812-47818834 GGGCAGAAAGTGCAGGCACATGG + Intergenic
1185245298 22:49770014-49770036 GGGCAGAAACGTGAGGCTTAGGG - Intergenic
949111815 3:270116-270138 GGCCAGAAATGGGGGGAAGGGGG + Intronic
949562285 3:5213918-5213940 GGGCAGAAGCTGGAGGCCGAGGG + Intronic
949932722 3:9091816-9091838 GGAAGAAAATGGGAGGCAGAGGG - Intronic
949988568 3:9559170-9559192 GTGCAGAAATGGAACTCAGATGG - Intergenic
951084337 3:18493177-18493199 GGGAAGATGAGGGAGGCAGAAGG - Intergenic
951417349 3:22441150-22441172 GGGTGAAAATGGGAGGCAGGGGG - Intergenic
952106727 3:30078780-30078802 GGGCAGAAATAGGAGAAGGATGG - Intergenic
952231130 3:31432174-31432196 TGGCAGCAATGGCAGGCAGTTGG - Intergenic
952958687 3:38576483-38576505 GGGCAGACACGTCAGGCAGATGG + Intronic
953099377 3:39809924-39809946 GGGGAGAAGAGGGAGGCGGACGG - Intronic
953140702 3:40226895-40226917 GGTAGGAAAAGGGAGGCAGAGGG - Intronic
953385488 3:42503488-42503510 AAGCAGAAGTGGGAGGAAGAGGG - Intronic
953389912 3:42527957-42527979 GGGCAGATCTGGGAGGCCAAAGG - Intronic
953876202 3:46668174-46668196 GGGCAGAACAGGGTGGCAGATGG + Intergenic
953916399 3:46923515-46923537 GAGAAGGAATGGGGGGCAGAGGG + Intronic
954284888 3:49611896-49611918 GGGAAGAGAAGGCAGGCAGATGG - Intronic
954380057 3:50214552-50214574 TGGCAGCAGTGGGAGGCTGAGGG + Intronic
954584470 3:51721281-51721303 GGGGGGTTATGGGAGGCAGAGGG + Intergenic
954614605 3:51963309-51963331 AGCCTGAAAGGGGAGGCAGATGG - Intronic
954646120 3:52132590-52132612 GGGCAGATTTGAGAGGCAGAGGG + Intronic
954663282 3:52237441-52237463 GGCCAGAAATGGGAAGAAGTGGG + Intronic
954672556 3:52298700-52298722 CAGCAGGAGTGGGAGGCAGAGGG - Intergenic
954672628 3:52298941-52298963 GGGGAGAAAGGGGGGGCAGCGGG + Intergenic
955027704 3:55186487-55186509 GGGCAGTACAGGGATGCAGAGGG + Intergenic
955215009 3:56977941-56977963 GGGCAGTGACGGGAGGCTGAGGG - Intronic
955571432 3:60310858-60310880 GTGCACAAATGATAGGCAGATGG - Intronic
955591198 3:60537669-60537691 GGGCAGGAAAGGGAGGCTGAAGG + Intronic
955868279 3:63409002-63409024 GGGTAGAAAAGGGAGGAAGAGGG - Intronic
956388220 3:68743722-68743744 AGCCAGAAAGGGGAGCCAGATGG + Intronic
957350046 3:79012893-79012915 GGGCTGAAAGTGGAGGGAGAAGG + Intronic
957743361 3:84304354-84304376 GGCTAGAAATAGCAGGCAGAAGG + Intergenic
958463816 3:94433095-94433117 TGGCAGAACAGGGAGGCAGTAGG - Intergenic
958772815 3:98446379-98446401 GTGGAGAAATGGGAGGTAGTAGG + Intergenic
959234740 3:103705825-103705847 GGGCAGATATGAGAGTCTGAAGG + Intergenic
960012460 3:112848833-112848855 GGGCTGAAGGGGGAGGAAGATGG + Intergenic
960528121 3:118733582-118733604 GGGCAGGAATGGGGGTCACAAGG + Intergenic
961056058 3:123789691-123789713 GGGAAGAGATGGGAAGGAGAGGG + Intronic
961146664 3:124599488-124599510 GAACAGAAATGAGAGACAGATGG - Intronic
961484446 3:127207262-127207284 GGGCAGCAGTGGGAAGCAGAGGG + Intergenic
961722462 3:128906034-128906056 GGGGAGGCATGGGAGGCACACGG - Intronic
961784922 3:129341914-129341936 GGGAGGAAATGGGAGGTAGCAGG - Intergenic
962106931 3:132399969-132399991 GTGAAGAAATGGGTGGCAGAAGG - Intergenic
962201114 3:133401852-133401874 GGGATGAAGTGGGAGGCAGGAGG - Intronic
962208060 3:133451866-133451888 AGTCAGAAATGGGTGGGAGATGG - Intronic
962352555 3:134666463-134666485 GGGGAGAGATGAGAGGGAGATGG - Intronic
962881152 3:139577996-139578018 GGCAGGAAATGGGAGGCAAAGGG - Intronic
962924226 3:139976961-139976983 GAGCAGGAAGAGGAGGCAGATGG - Intronic
962986978 3:140544938-140544960 GGGCAGACATGGAAGGTATATGG + Intronic
963254163 3:143128248-143128270 GAGAAGAAATGGGAGGCAGGGGG - Intergenic
963833345 3:150032016-150032038 GGGCAGGAATGAAAGGAAGAGGG - Intronic
964694194 3:159488558-159488580 GGGCAGAGCTGAGAGACAGATGG + Intronic
964835038 3:160928947-160928969 AGGCAGAGATGCAAGGCAGATGG + Intronic
965024531 3:163283532-163283554 GGGCTGAAATGGGTGGGAGTGGG + Intergenic
965433729 3:168621043-168621065 GGCCAGAAAGGGGCGACAGAGGG - Intergenic
965437636 3:168672065-168672087 AGGAAGAAATGGAAGGAAGAAGG - Intergenic
965765467 3:172125539-172125561 GGGAAGAAAAGGTAGGCAAAAGG - Intronic
966422520 3:179747464-179747486 GAGCAGAAAGGGGTGGCCGAGGG - Intronic
966652845 3:182320707-182320729 AGGCTGAAGTGGTAGGCAGAAGG + Intergenic
967027199 3:185575329-185575351 GGGGAGATGTGGGAGGCACATGG + Intergenic
967075182 3:185995444-185995466 CTGCAGAACTGGGAGACAGAGGG + Intergenic
967188360 3:186964584-186964606 AGGTAGAAAGGTGAGGCAGAAGG + Intronic
967830192 3:193912152-193912174 AAGCAGAGATGGCAGGCAGAAGG - Intergenic
967884230 3:194322380-194322402 GGACAGAAAAGGGAAGCAGGTGG + Intergenic
968261100 3:197324787-197324809 GGCCAGGATTGGGAGGCAGAAGG + Intergenic
968261107 3:197324810-197324832 GGCCAGGATTGGAAGGCAGAAGG + Intergenic
968261115 3:197324833-197324855 GGCCAGGATTGGGAGGCAGAAGG + Intergenic
968862607 4:3184643-3184665 GGGCAGACATTGGGGGCAGCAGG + Intronic
968927309 4:3556334-3556356 GGACAGACCCGGGAGGCAGATGG - Intergenic
969293203 4:6253502-6253524 GGGCAGACAGGGGAGGAAGTGGG + Intergenic
969591821 4:8126458-8126480 GAGGAGAAAAGGGAGGCAGGGGG - Intronic
969657677 4:8507529-8507551 GGAAAGAAAGGGGAGGGAGATGG - Intergenic
969664868 4:8551559-8551581 AGAAAGAAAGGGGAGGCAGAGGG - Intergenic
969944007 4:10764287-10764309 AGGTAGAGATGGGAGGCAGCAGG + Intergenic
970088027 4:12369481-12369503 GGGCAGAAGTGGGGGTCACAAGG - Intergenic
970301315 4:14684143-14684165 GGGAAGAAAAAGGAGGGAGAAGG + Intergenic
970522448 4:16899324-16899346 GGGGAGAGATGGGAGTGAGATGG - Intergenic
971150975 4:24031271-24031293 GGCCAGAAATGGAATGCAAATGG - Intergenic
972170714 4:36342353-36342375 GTTCAGTAATGGAAGGCAGATGG + Intronic
974321305 4:60353703-60353725 GAGCTGAAATGGGAGACAGGTGG - Intergenic
974880874 4:67756198-67756220 GGGAAGGAATGGGAGGAAAAGGG - Intergenic
975296280 4:72738196-72738218 AGGCAGAAAGGGGAGGAAGCTGG + Intergenic
976476526 4:85490108-85490130 GGGCAGAAATGGGAGGGAGAGGG + Intronic
978661332 4:111130249-111130271 GGGCACAAATGGGAGAAAGTAGG - Intergenic
979301619 4:119093521-119093543 AGTCAGAAGTGGGAGGAAGAGGG + Intergenic
980112289 4:128646385-128646407 GGGCAGGAGTGGGAGTCACAAGG + Intergenic
980471941 4:133263736-133263758 GGGCAGGAGTGGGAGTCACAAGG + Intergenic
981955201 4:150463899-150463921 GGGCAGAGAATGGAGGCAGTTGG + Intronic
982557473 4:156886126-156886148 GGGCAGAAATGGAACACAGTGGG + Intronic
983294128 4:165844014-165844036 AGGCAATAATGGGAGGCAGAAGG - Intergenic
983447724 4:167876512-167876534 GGGCAGGAATGGGGGTCACAAGG - Intergenic
983569909 4:169194821-169194843 TGGCAGAGATGTGAGGCAGCAGG - Intronic
985487336 5:158795-158817 GGGCAGAGTGGGGAGGGAGATGG - Intronic
985641403 5:1065034-1065056 GGACAGCGAGGGGAGGCAGAGGG + Intronic
985703254 5:1386210-1386232 GGGCAGAAGGGGGAGTCAGCCGG - Intergenic
986105780 5:4658129-4658151 AAGTGGAAATGGGAGGCAGAAGG - Intergenic
986153395 5:5148863-5148885 GGACAGGCATGGGAGCCAGAAGG + Intronic
986614726 5:9604634-9604656 GGGGTGAGATGGGAGGAAGAGGG + Intergenic
986903565 5:12467359-12467381 GGGCTGAAGTGGGAGGAAGCTGG + Intergenic
987397990 5:17443583-17443605 GAGCAGACAGGGGAGACAGAAGG - Intergenic
988577960 5:32444695-32444717 GGGCAGAGGAGGGAGGCAGCGGG - Exonic
988846758 5:35135405-35135427 GGGGAGAAAAGGCAGCCAGAGGG + Intronic
989107701 5:37879211-37879233 GGGCAGAAATCAGAGTCCGAGGG - Intergenic
989740537 5:44766123-44766145 GTGTAGAAATGGGAGAAAGAAGG - Intergenic
990743042 5:58931932-58931954 GGGAGTGAATGGGAGGCAGAGGG - Intergenic
990916860 5:60915926-60915948 GGGTACAAATAGGAGGTAGATGG - Intronic
991265854 5:64716521-64716543 GGGGAGAAATGGAGGACAGAAGG + Intronic
991570829 5:68051633-68051655 GCAGAGAAATGGGAAGCAGATGG - Intergenic
991649706 5:68839238-68839260 GGGAAGAAATGTGAACCAGATGG - Intergenic
991973128 5:72160124-72160146 GAGCATAAATGGGAATCAGAAGG + Intronic
992787722 5:80185690-80185712 GGGCAGGAATGGGAGTCGCAAGG + Intronic
993654296 5:90558751-90558773 GGGGAGAAAGGGGAGGAGGATGG + Intronic
994134714 5:96272590-96272612 GGCCAAAAATGGTAGGGAGAGGG + Intergenic
994363784 5:98886984-98887006 GGGCAGAAGAGGAAGGCAAATGG + Intronic
994451761 5:99951990-99952012 AGGCAGCAGTGGGAGGCTGATGG + Intergenic
995124298 5:108564751-108564773 GGAGAGAAGTGGGAGGCAGTTGG + Intergenic
995296538 5:110531135-110531157 GGGCAGAAGTGGGGGTCACAGGG - Intronic
996370298 5:122746205-122746227 GGTCAAAAAAGGGAGGCAGAAGG + Intergenic
996615495 5:125436288-125436310 GGGGAAAAATGAGAGGCACACGG + Intergenic
998302709 5:141040308-141040330 GGGCAGAGAAGGGAGGAAGAGGG + Intergenic
998735174 5:145129276-145129298 GGGGAGAAGTGGGAGGTATATGG + Intergenic
999049780 5:148509911-148509933 GAGGAGAAATGGGATGTAGAAGG + Exonic
999181999 5:149676308-149676330 GGGGAGAAATGGGAAGCAGAGGG + Intergenic
999215786 5:149933848-149933870 GGTCAGGACTGGCAGGCAGATGG - Intronic
999381882 5:151127082-151127104 AGGAAGAAAGGGGAGGCTGAAGG - Intronic
999684124 5:154087235-154087257 GGAGAGAGATGGGAGACAGAAGG - Intronic
1001051522 5:168418258-168418280 GGGAAGGAGGGGGAGGCAGAGGG - Intronic
1002352439 5:178592405-178592427 GGGCAGAGAGCAGAGGCAGAAGG + Intergenic
1002449047 5:179308785-179308807 GGGAAGGAAGAGGAGGCAGAGGG - Intronic
1003460556 6:6324257-6324279 CGGCAGACAAGGGAGGGAGAGGG - Intergenic
1003670018 6:8148478-8148500 GGGGAGAGATGGGAACCAGAGGG + Intergenic
1004264812 6:14139996-14140018 TGGAAGAGATGGGAGGCAGGAGG + Intergenic
1004676433 6:17847257-17847279 AGGCAGAAATGGGAGTGTGAAGG - Intronic
1004938862 6:20534716-20534738 TGGGGGAATTGGGAGGCAGATGG + Intronic
1005814795 6:29541768-29541790 GTGCAGAAATGGAAGGTAGATGG - Intergenic
1006257888 6:32845533-32845555 GAGAAGAAAAGGGAGGGAGATGG + Exonic
1006898883 6:37487284-37487306 GGGCACAAAGAGGAGACAGATGG - Intronic
1007028425 6:38602752-38602774 AGACAGAAATGGCAAGCAGAAGG + Intronic
1007273621 6:40657566-40657588 GGGCTGAAATTGGAGGCCCAAGG - Intergenic
1007273722 6:40658231-40658253 GTCCAGAAGAGGGAGGCAGATGG - Intergenic
1007728405 6:43930890-43930912 GGACAAAAATGACAGGCAGAGGG + Intergenic
1007937027 6:45741578-45741600 GGGCAGAAACAGGAGGGAGAGGG - Intergenic
1007938337 6:45753725-45753747 GGGTTAAAAAGGGAGGCAGAAGG + Intergenic
1009355515 6:62739916-62739938 GGGCTGAAGTGGGAGAAAGATGG + Intergenic
1009734949 6:67663743-67663765 GGGCTGAAGTGGGAGGAAGCTGG - Intergenic
1009848135 6:69160299-69160321 GGGCAGAGATGAAAGGCAGGAGG - Intronic
1009851183 6:69201269-69201291 GGGGAGAGAGGGGAGGCAGCAGG - Intronic
1010717714 6:79248798-79248820 GGGGAGCTGTGGGAGGCAGAAGG - Intergenic
1010807127 6:80250478-80250500 TGACAGAAATGGGAGGGAAAAGG + Intronic
1011840762 6:91495716-91495738 GGGCAAGAGTGGGATGCAGAAGG + Intergenic
1012246351 6:96930550-96930572 GTGGGGAAAGGGGAGGCAGAGGG - Intronic
1012456814 6:99416175-99416197 GGACAAAAAGGGGAGGAAGAAGG - Intronic
1012692329 6:102328962-102328984 GGGCTGAAATGGGAGGAAGCTGG - Intergenic
1012734137 6:102917581-102917603 AGGCAGACATCGGGGGCAGATGG + Intergenic
1013166037 6:107593092-107593114 TGGCAGAAATGGGAGCCAACAGG - Intronic
1013597188 6:111670788-111670810 GGGGAGAAACTGGAAGCAGAGGG + Intronic
1013976274 6:116082373-116082395 GGACAGAATTGGGATGGAGAGGG + Intergenic
1014465422 6:121750873-121750895 GGGGAGCAAGGGGAGGAAGAGGG - Intergenic
1015055887 6:128902710-128902732 GGGCAAAGATGGGTGACAGAGGG - Intronic
1015437071 6:133201930-133201952 GGGCAGCAATGGGAAGGATAAGG - Intergenic
1016272778 6:142308263-142308285 GGTAAGAAATAGGAGGCACAAGG + Intronic
1016324561 6:142885324-142885346 GAGAAGAAAGGGGAGGGAGAAGG - Intronic
1017258872 6:152364350-152364372 GGAAAGAAATGGCAGGCAGGGGG - Intronic
1017989689 6:159475394-159475416 GAGCAGAACTGGGAGGAAGTTGG - Intergenic
1018476231 6:164144842-164144864 GGGCAGCTTTGGGAGGCAGCCGG + Intergenic
1018683617 6:166284663-166284685 GGGCAGAGATGGGCTGGAGATGG - Intergenic
1018948563 6:168364041-168364063 CGGCAGCAAAGGGAGGCAAAGGG + Intergenic
1019104859 6:169659927-169659949 GGGCAGGGATGGGCGGCTGAAGG + Intronic
1019200281 6:170308155-170308177 TGGCAGAAATGGGATGAAGAAGG - Intronic
1019415211 7:923902-923924 GGGCAGACGTGGGAGGAAGGTGG + Intronic
1019590250 7:1827290-1827312 GGGAAGAAAGGGGACGCAGCGGG + Intronic
1020894326 7:13920605-13920627 AGGCAGTAATGGAAGGCTGAAGG - Intronic
1020989429 7:15178894-15178916 GGCAGGAAATGGCAGGCAGAGGG + Intergenic
1022490872 7:30816613-30816635 GGACAGATTTGGGAGGCAGGGGG - Intronic
1022498304 7:30866788-30866810 GGGAAGAGGTGGGTGGCAGAAGG + Intronic
1022838919 7:34144092-34144114 GGGCTGAGATGGGATGAAGAGGG + Intronic
1022982817 7:35620450-35620472 AGGCAGAAATGGGAGGATGAAGG + Intergenic
1023376909 7:39565824-39565846 GAACAGGAATGGGAGGCAGAAGG + Intergenic
1023505894 7:40899325-40899347 GTGCCAAAATGGGAGGCGGAGGG - Intergenic
1023697104 7:42858866-42858888 GGGAGGAACTGGCAGGCAGAGGG - Intergenic
1023836113 7:44068167-44068189 GGGCAGAAAGGAGCTGCAGAAGG - Intronic
1023872331 7:44269700-44269722 GGGCAGGAGGGGGAGGCACAAGG + Intronic
1024292881 7:47818174-47818196 AGACAGAGATGGGAGGCATAAGG + Exonic
1024950717 7:54857814-54857836 AGGCAGAAATGAGAGGCAAATGG + Intergenic
1025021129 7:55481085-55481107 GGGCAGAAGGGGCAGGCAGCAGG + Intronic
1025965955 7:66271524-66271546 GGGCAGAAATGGGAGGAAATGGG - Intronic
1026307403 7:69153963-69153985 GGACAGAAATGGGGCGAAGAAGG + Intergenic
1026452017 7:70537805-70537827 GAGCAGAAATGGAAGTAAGAAGG + Intronic
1028285177 7:88987901-88987923 GGGAAGAAAAGGGAGGAGGAGGG - Intronic
1029530526 7:101122280-101122302 GGGAAGAAAGGGTAGGCAGGAGG + Intergenic
1029587662 7:101485761-101485783 TGGGAGCAGTGGGAGGCAGAGGG + Intronic
1029877697 7:103771366-103771388 GGGCAGGAGTGGGAAGAAGAGGG - Intronic
1029913819 7:104185019-104185041 GGGCAGAAAGGGGGGCCAGCTGG - Intronic
1029946571 7:104539521-104539543 AGGCAGAAATGGGTGGGAGGAGG + Intronic
1030124477 7:106141489-106141511 GGGGAGAAGGGGGAGGTAGAGGG - Intergenic
1030124490 7:106141518-106141540 GGGGAGAAGGGGGAGGTAGAGGG - Intergenic
1030124537 7:106141623-106141645 GGGGAGAAGGGGGAGGTAGAGGG - Intergenic
1030396687 7:108995144-108995166 AGGCAGAGTGGGGAGGCAGAGGG - Intergenic
1031354679 7:120776800-120776822 GGGCAGGAATGGGGGTCACAAGG + Intergenic
1031355560 7:120782662-120782684 GGGCAGGAATGGGGGTCACAAGG + Intergenic
1031421956 7:121563823-121563845 GGGCAGGAATGGGGGTCACAAGG + Intergenic
1031891038 7:127293845-127293867 GGGCTGAAGTGGGAGGAAGCTGG + Intergenic
1032255619 7:130294965-130294987 GGGGAGATAGGTGAGGCAGATGG - Intronic
1032503613 7:132418790-132418812 GGGAAGAAGTGAGAGGCAGAGGG + Intronic
1032511361 7:132475185-132475207 GAGCAGTAGTGGGAGGCAGCAGG + Intronic
1033229314 7:139584141-139584163 GGGCAGGGGAGGGAGGCAGAGGG + Intronic
1033742284 7:144284479-144284501 GAGCAGAAATGGGAGGAAGGTGG + Intergenic
1033751618 7:144365135-144365157 GAGCAGAAATGGGAGGAAGGTGG - Exonic
1034271788 7:149806658-149806680 GGGAAGGGAAGGGAGGCAGAGGG - Intergenic
1034275717 7:149823004-149823026 GGGCAGAGATGGGAGACAGAGGG - Intergenic
1034487872 7:151377437-151377459 ACGCAGACCTGGGAGGCAGATGG - Exonic
1034937534 7:155209690-155209712 GGGCAGGAACAGGAGGCACAGGG - Intergenic
1035050709 7:155997668-155997690 GGGGTGACATGGGAGGCAGGCGG + Intergenic
1035242939 7:157543950-157543972 GGAGAGAGATGGGAGACAGATGG + Intronic
1035331320 7:158098984-158099006 GGGGAGGAAGGGGAGGCAGCCGG - Intronic
1035331332 7:158099016-158099038 GGGGAGGAAGGGGAGGCAGCCGG - Intronic
1035331345 7:158099049-158099071 GGGGAGGAAGGGGAGGCAGCCGG - Intronic
1035331357 7:158099079-158099101 GGGGAGGAAGGGGAGGCAGCCGG - Intronic
1035331382 7:158099139-158099161 GGGGAGGAAGGGGAGGCAGCCGG - Intronic
1035331433 7:158099262-158099284 GGGGAGGAAGGGGAGGCAGCCGG - Intronic
1035331446 7:158099292-158099314 GGGGAGGAAGGGGAGGCAGCCGG - Intronic
1035331459 7:158099322-158099344 GGGGAGGAAGGGGAGGCAGCCGG - Intronic
1035331471 7:158099352-158099374 GGGGAGGAAGGGGAGGCAGCCGG - Intronic
1035331484 7:158099385-158099407 GGGGAGGAAGGGGAGGCAGCCGG - Intronic
1035331497 7:158099415-158099437 GGGGAGGAAGGGGAGGCAGCCGG - Intronic
1035331509 7:158099445-158099467 GGGGAGGAAGGGGAGGCAGCCGG - Intronic
1035331522 7:158099478-158099500 GGGGAGGAAGGGGAGGCAGCCGG - Intronic
1035331535 7:158099508-158099530 GGGGAGGAAGGGGAGGCAGCCGG - Intronic
1035331547 7:158099538-158099560 GGGGAGGAAGGGGAGGCAGCCGG - Intronic
1035331560 7:158099571-158099593 GGGGAGGAAGGGGAGGCAGCCGG - Intronic
1035331573 7:158099604-158099626 GGGGAGGAAGGGGAGGCAGCCGG - Intronic
1035331585 7:158099634-158099656 GGGGAGGAAGGGGAGGCAGCCGG - Intronic
1035331599 7:158099663-158099685 GGGGAGGAAGGGGAGGCAGCCGG - Intronic
1035331612 7:158099696-158099718 GGGGAGGAAGGGGAGGCAGCCGG - Intronic
1035331635 7:158099757-158099779 GGGGAGGAAGGGGAGGCAGCCGG - Intronic
1035331648 7:158099790-158099812 GGGGAGGAAGGGGAGGCAGCCGG - Intronic
1035654223 8:1293348-1293370 GCCCAGAAAAGGGAGGCACAGGG - Intergenic
1035654249 8:1293447-1293469 GCCCAGAAAAGGGAGGCACAGGG - Intergenic
1035721936 8:1798855-1798877 AGGCAGCAATGGGAAGCAGGAGG - Intergenic
1035785820 8:2260016-2260038 AGGCAGAAGCGGGAGGCAGAAGG - Intergenic
1035806987 8:2461700-2461722 AGGCAGAAGCGGGAGGCAGAAGG + Intergenic
1036474585 8:9081563-9081585 GTGAAGAAATGGGTAGCAGAGGG - Intronic
1036760574 8:11506030-11506052 GGGCCCAACAGGGAGGCAGATGG + Intronic
1036969135 8:13334399-13334421 TGGCAGAAATGGGGAGCAGCTGG + Intronic
1037029742 8:14090376-14090398 GAGCAGAACTGTGAAGCAGACGG + Exonic
1037241832 8:16786157-16786179 AGGCAGAAATGGGAGGGATGTGG + Intergenic
1037340916 8:17844072-17844094 AGTCAGAAATTGGAGGAAGAGGG + Intergenic
1037342661 8:17863216-17863238 GGGGAGATATTGCAGGCAGAGGG - Intergenic
1038124808 8:24661510-24661532 GGGAGGAACTGGGAGGTAGAAGG - Intergenic
1038338571 8:26664742-26664764 GGGCAGAAAGGGAAGACAGGAGG - Intergenic
1038699861 8:29839946-29839968 GGGGAGAAGTGGGAGGCCCAGGG - Intergenic
1038721026 8:30035459-30035481 GGGCAGAAGTGGGGGTCACAAGG - Intergenic
1039415524 8:37390642-37390664 GGCCAGAAGGGGGAGGCTGAAGG + Intergenic
1040379924 8:46862629-46862651 GGGCAGAAAAAACAGGCAGAAGG - Intergenic
1040707251 8:50144259-50144281 GGCCACAGATGGAAGGCAGATGG + Intronic
1041636247 8:60148361-60148383 GGCAAGAAATGGGAGTGAGAAGG + Intergenic
1042568201 8:70134036-70134058 GGGCAGAAAGGGGCGGGAGTGGG - Intronic
1042727074 8:71889957-71889979 GGGCTGAAAGGGGAGGAAGCTGG - Intronic
1043004017 8:74795989-74796011 GAGCAGCAATGGAAAGCAGAGGG + Intronic
1045113323 8:98953899-98953921 TGGAAGAAATGGGAATCAGAAGG + Intergenic
1045728060 8:105199477-105199499 TGGGAGAAGAGGGAGGCAGAGGG - Intronic
1046178991 8:110618289-110618311 GGGGAGAAGGGGGAGGAAGAAGG - Intergenic
1046612910 8:116445317-116445339 GGGCAGAAGGTGGAGGGAGAAGG + Intergenic
1047966307 8:130049175-130049197 GGGAACACATGGGGGGCAGAGGG + Intergenic
1047966328 8:130049237-130049259 GGGAACATATGGGGGGCAGAGGG + Intergenic
1047966349 8:130049299-130049321 GGGAACACATGGGGGGCAGAGGG + Intergenic
1047966376 8:130049382-130049404 GGGAACACATGGGGGGCAGAGGG + Intergenic
1047966437 8:130049568-130049590 GGGAATACATGGGGGGCAGAGGG + Intergenic
1047966451 8:130049610-130049632 GGGAACACATGGGGGGCAGAGGG + Intergenic
1047966504 8:130049775-130049797 GGGAACACATGGGGGGCAGAGGG + Intergenic
1047966579 8:130050003-130050025 GGGAACACATGGGGGGCAGAGGG + Intergenic
1047970587 8:130080968-130080990 AGGCATAAATGTGAAGCAGAAGG + Intronic
1048589334 8:135806477-135806499 GGGCAGAAATGAGTGGCAAATGG + Intergenic
1049155179 8:141061895-141061917 GGGCAGTGATGGGAGGAGGAGGG + Intergenic
1049351496 8:142167134-142167156 GAGCAGAAGTGCCAGGCAGATGG + Intergenic
1049409238 8:142465038-142465060 GGGCAGACAGGGGAGGCGGGCGG + Intronic
1049687943 8:143946454-143946476 GGGAAGGGGTGGGAGGCAGAGGG + Intronic
1049983969 9:931002-931024 AGGCAGAAATGGGAGTAATATGG - Intronic
1050610011 9:7342314-7342336 GGGCAAAAAGAGGAGGAAGAGGG + Intergenic
1050908691 9:11038875-11038897 GGGCAGGAGTGGGAGTCACAAGG - Intergenic
1051154312 9:14123771-14123793 GGGGCAAACTGGGAGGCAGAGGG - Intronic
1051194198 9:14545536-14545558 GGGGAGAAATGGAAAGAAGACGG + Intergenic
1051527565 9:18063972-18063994 GGGGAGAGAAGGGAGGCAGTGGG - Intergenic
1051819706 9:21150043-21150065 GGGCTGAAAGGGGAGGGAGTTGG - Intergenic
1052112740 9:24608950-24608972 GGGTAGAAGGGGGAGGGAGATGG - Intergenic
1052495958 9:29224494-29224516 GGGTAGAAGTAGGAGGGAGATGG + Intergenic
1053024397 9:34718253-34718275 AGGCAGAAAAGGGGGGCAGTTGG + Intergenic
1053192009 9:36079713-36079735 GGGCATAAATTACAGGCAGAAGG - Intronic
1053428710 9:38027828-38027850 GGCCAGACTGGGGAGGCAGAAGG + Intronic
1053802232 9:41771744-41771766 GGACAGACCGGGGAGGCAGATGG - Intergenic
1053885799 9:42644459-42644481 GGGAAAAAATGGGGGGTAGATGG - Intergenic
1054224817 9:62451908-62451930 GGGAAAAAATGGGGGGTAGATGG - Intergenic
1054462745 9:65474426-65474448 GGACAGACCCGGGAGGCAGATGG + Intergenic
1054647853 9:67604687-67604709 GGACAGACCGGGGAGGCAGATGG + Intergenic
1054882847 9:70163164-70163186 GAGCAGAAATGCAAGGCAGATGG - Intronic
1055006458 9:71512962-71512984 GGGATGAAATGGGGGGCATAAGG - Intergenic
1055690640 9:78826710-78826732 GAGCAGAAGAGGGAGGCAGGTGG + Intergenic
1055914722 9:81389380-81389402 GGGGAGAGATGGAAGGCACAGGG + Intergenic
1055988374 9:82077813-82077835 GGGAAGAGAAGGGAGGCAGTGGG + Intergenic
1056063533 9:82909694-82909716 GGGCAGAGATGGGAGTGAGGTGG - Intergenic
1056089193 9:83187743-83187765 GAGGAGAAATGGAAGGTAGAGGG - Intergenic
1056252164 9:84760754-84760776 GGGCAGGAATGGGAGGGGGATGG + Intronic
1056253005 9:84770010-84770032 GGCCAGTAAAGGGAGTCAGAGGG - Intronic
1056419149 9:86407010-86407032 GGGCAGAAATGAGAGGGTAAAGG - Intergenic
1056870556 9:90273464-90273486 GGGCAGAGATGACAGGCAGCTGG - Intergenic
1057082956 9:92186691-92186713 GGGAAGGAGAGGGAGGCAGAGGG - Intergenic
1057646804 9:96884156-96884178 TGGCAGAAGTGGGTGGCAGGAGG + Intergenic
1057699883 9:97356065-97356087 AGGCAGAAGTGTGAGGCTGATGG + Intronic
1058041930 9:100312204-100312226 GGGCAGCAAGGGGAGGCAGAAGG - Intronic
1058277587 9:103064431-103064453 TGGGACAAATGGGAGGCAGAAGG - Intergenic
1058669360 9:107347642-107347664 AGGCAGAAATGGAAGCTAGAGGG - Intergenic
1059658943 9:116382375-116382397 GGGCTGGAAAGGGAGACAGAAGG - Exonic
1060206293 9:121684674-121684696 GGGCACAAATGGGGGGCAGCGGG - Intronic
1061080945 9:128369911-128369933 GGGCAGAAATGGAATGAAGTTGG - Intergenic
1061251897 9:129431328-129431350 TGGGAGCAATTGGAGGCAGAGGG - Intergenic
1061290242 9:129646578-129646600 GAGCCCTAATGGGAGGCAGATGG - Intergenic
1061393197 9:130329143-130329165 GAGCAGAAATGGGGGGCTGGTGG - Intronic
1061403428 9:130381019-130381041 GGGCAGGACTGGGGGGCAGTTGG - Intronic
1061680802 9:132241665-132241687 GGGCAGCGGTGGGAGGCAGCCGG + Intronic
1062187679 9:135227362-135227384 GGGCAGGAAAGGGAGGCTGTGGG + Intergenic
1062261851 9:135666809-135666831 GGGCAGAGAGGGGAGGGACAGGG - Intergenic
1186223198 X:7371427-7371449 GGGAAGAAATTCTAGGCAGAAGG + Intergenic
1187589379 X:20699740-20699762 ATGCAGAAATTGAAGGCAGATGG + Intergenic
1188332472 X:28892305-28892327 GGGCAGGAGTGGGGGTCAGAAGG + Intronic
1188333330 X:28897899-28897921 GGGCAGGAGTGGGGGTCAGAAGG + Intronic
1188492956 X:30755610-30755632 GGGCTGAAGTGGGAGGAAGCTGG + Intergenic
1188537398 X:31212788-31212810 GGGGAAAAGTGGGTGGCAGAAGG + Intronic
1188552350 X:31377964-31377986 GGGCAGGAGTGGGAGTCACAAGG - Intronic
1189262777 X:39689693-39689715 GGGCAGGAATAGGGGACAGAGGG + Intergenic
1189779659 X:44502028-44502050 GGCTAGAAATGGGAAGCAGCAGG - Intergenic
1189946269 X:46182839-46182861 TAGCAGCAATGGAAGGCAGATGG - Intergenic
1190039436 X:47057873-47057895 GGGCAGAGATGGGACGCAGGAGG + Intronic
1192215448 X:69154897-69154919 GGGCAGAAATCTCAGGCAAAGGG - Intergenic
1192333550 X:70199483-70199505 GGGAAGGAAGGGGAGGGAGAAGG + Intronic
1192682510 X:73266855-73266877 GGCCAGAACTGGGAGGCAAATGG + Intergenic
1192872318 X:75195727-75195749 GGGCTGAAAGGGGAGGAAGCTGG - Intergenic
1193250669 X:79288147-79288169 GGGCTGAAGGGGGAGGAAGATGG + Intergenic
1193703297 X:84790539-84790561 GGGCTGAAGTGGGAGGAAGCTGG + Intergenic
1194270842 X:91812800-91812822 GGGAAGAACTGCGAGGCACAAGG - Intronic
1194298292 X:92154810-92154832 GGGCAGATGGGGGAGCCAGAAGG - Intronic
1194670885 X:96730972-96730994 GGGCAGGAGTGGGAGTCACAAGG + Intronic
1194714990 X:97277694-97277716 GGGTAAGAATGGGAGGCATAAGG - Intronic
1194774258 X:97943877-97943899 GGGCTGAAGTGGGAGGAAGCTGG + Intergenic
1195129579 X:101839829-101839851 AGGCAGGAGTGGAAGGCAGAGGG - Intronic
1195176660 X:102320000-102320022 AGGCAGGAGTGGAAGGCAGAGGG + Intronic
1195182204 X:102367093-102367115 AGGCAGGAGTGGAAGGCAGAGGG - Intronic
1195254926 X:103081610-103081632 AGGCAGGAGTGGAAGGCAGAGGG - Intronic
1195390702 X:104359023-104359045 GTGGGGAAATGGGAGGCAGGTGG + Intergenic
1195399328 X:104445139-104445161 GGACAGATATGGGAAGCAGAAGG - Intergenic
1196221325 X:113114161-113114183 AGGCAGAAGTGGGAGTCACAAGG + Intergenic
1196391133 X:115208643-115208665 TGGCAGAAATGGTAGCCAGTGGG - Intronic
1196637401 X:118019191-118019213 GGGAAGAAATGGGAAGAAGAAGG - Intronic
1197471456 X:126868783-126868805 GGGCAGGAATGGGGGTCACAAGG - Intergenic
1197638457 X:128942283-128942305 GGACAGAATTGGGATGCTGATGG + Intergenic
1197721459 X:129747499-129747521 GGGCTGCAAAGGGAGGCAAAGGG + Intronic
1198965262 X:142221637-142221659 GAGCAGAAAGAGAAGGCAGAGGG + Intergenic
1199272415 X:145899319-145899341 CTGCAGAAATGGAAGGCAGCAGG - Intergenic
1199279500 X:145983598-145983620 TACCAGAAATGGGGGGCAGAAGG + Intergenic
1200588081 Y:5034233-5034255 GGGAAGAACTGTGAGGCACAAGG - Intronic
1200615900 Y:5379770-5379792 GGGCAGATGGGGGAGCCAGAAGG - Intronic
1200764745 Y:7070940-7070962 GTGCAGACATAGGAGGCAGGTGG + Intronic
1201238082 Y:11930794-11930816 CAGCAGATAGGGGAGGCAGAGGG - Intergenic
1201581815 Y:15517875-15517897 GGGCAGGAATGGGGGTCACAAGG - Intergenic
1201592757 Y:15633696-15633718 GGGAAGAAATTCCAGGCAGAAGG + Intergenic
1201763184 Y:17559904-17559926 GGGCACAAAAGGGAGAAAGAGGG - Intergenic
1201838369 Y:18346086-18346108 GGGCACAAAAGGGAGAAAGAGGG + Intergenic
1202076890 Y:21044932-21044954 GGGCAGGAATGGGGGTCAAAAGG + Intergenic