ID: 1181568387

View in Genome Browser
Species Human (GRCh38)
Location 22:23753063-23753085
Sequence TCCTGGTACCAGCAGCGGGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 177}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181568387_1181568399 24 Left 1181568387 22:23753063-23753085 CCTGCCCGCTGCTGGTACCAGGA 0: 1
1: 0
2: 2
3: 14
4: 177
Right 1181568399 22:23753110-23753132 GTGCTGGGGGCTGAGCGTGCAGG 0: 1
1: 0
2: 4
3: 57
4: 574
1181568387_1181568395 10 Left 1181568387 22:23753063-23753085 CCTGCCCGCTGCTGGTACCAGGA 0: 1
1: 0
2: 2
3: 14
4: 177
Right 1181568395 22:23753096-23753118 TCCCTGATGGTGACGTGCTGGGG 0: 1
1: 0
2: 0
3: 8
4: 137
1181568387_1181568397 11 Left 1181568387 22:23753063-23753085 CCTGCCCGCTGCTGGTACCAGGA 0: 1
1: 0
2: 2
3: 14
4: 177
Right 1181568397 22:23753097-23753119 CCCTGATGGTGACGTGCTGGGGG 0: 1
1: 0
2: 1
3: 8
4: 176
1181568387_1181568391 -3 Left 1181568387 22:23753063-23753085 CCTGCCCGCTGCTGGTACCAGGA 0: 1
1: 0
2: 2
3: 14
4: 177
Right 1181568391 22:23753083-23753105 GGACACACCGTAGTCCCTGATGG 0: 1
1: 0
2: 0
3: 6
4: 67
1181568387_1181568393 8 Left 1181568387 22:23753063-23753085 CCTGCCCGCTGCTGGTACCAGGA 0: 1
1: 0
2: 2
3: 14
4: 177
Right 1181568393 22:23753094-23753116 AGTCCCTGATGGTGACGTGCTGG 0: 1
1: 0
2: 0
3: 4
4: 71
1181568387_1181568394 9 Left 1181568387 22:23753063-23753085 CCTGCCCGCTGCTGGTACCAGGA 0: 1
1: 0
2: 2
3: 14
4: 177
Right 1181568394 22:23753095-23753117 GTCCCTGATGGTGACGTGCTGGG 0: 1
1: 0
2: 0
3: 7
4: 89

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181568387 Original CRISPR TCCTGGTACCAGCAGCGGGC AGG (reversed) Exonic