ID: 1181568389

View in Genome Browser
Species Human (GRCh38)
Location 22:23753068-23753090
Sequence GTGTGTCCTGGTACCAGCAG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 383
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 354}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181568389_1181568393 3 Left 1181568389 22:23753068-23753090 CCGCTGCTGGTACCAGGACACAC 0: 1
1: 0
2: 1
3: 27
4: 354
Right 1181568393 22:23753094-23753116 AGTCCCTGATGGTGACGTGCTGG 0: 1
1: 0
2: 0
3: 4
4: 71
1181568389_1181568394 4 Left 1181568389 22:23753068-23753090 CCGCTGCTGGTACCAGGACACAC 0: 1
1: 0
2: 1
3: 27
4: 354
Right 1181568394 22:23753095-23753117 GTCCCTGATGGTGACGTGCTGGG 0: 1
1: 0
2: 0
3: 7
4: 89
1181568389_1181568399 19 Left 1181568389 22:23753068-23753090 CCGCTGCTGGTACCAGGACACAC 0: 1
1: 0
2: 1
3: 27
4: 354
Right 1181568399 22:23753110-23753132 GTGCTGGGGGCTGAGCGTGCAGG 0: 1
1: 0
2: 4
3: 57
4: 574
1181568389_1181568395 5 Left 1181568389 22:23753068-23753090 CCGCTGCTGGTACCAGGACACAC 0: 1
1: 0
2: 1
3: 27
4: 354
Right 1181568395 22:23753096-23753118 TCCCTGATGGTGACGTGCTGGGG 0: 1
1: 0
2: 0
3: 8
4: 137
1181568389_1181568397 6 Left 1181568389 22:23753068-23753090 CCGCTGCTGGTACCAGGACACAC 0: 1
1: 0
2: 1
3: 27
4: 354
Right 1181568397 22:23753097-23753119 CCCTGATGGTGACGTGCTGGGGG 0: 1
1: 0
2: 1
3: 8
4: 176
1181568389_1181568391 -8 Left 1181568389 22:23753068-23753090 CCGCTGCTGGTACCAGGACACAC 0: 1
1: 0
2: 1
3: 27
4: 354
Right 1181568391 22:23753083-23753105 GGACACACCGTAGTCCCTGATGG 0: 1
1: 0
2: 0
3: 6
4: 67

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181568389 Original CRISPR GTGTGTCCTGGTACCAGCAG CGG (reversed) Exonic