ID: 1181568390

View in Genome Browser
Species Human (GRCh38)
Location 22:23753080-23753102
Sequence TCAGGGACTACGGTGTGTCC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 106}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181568390_1181568402 30 Left 1181568390 22:23753080-23753102 CCAGGACACACCGTAGTCCCTGA 0: 1
1: 0
2: 1
3: 5
4: 106
Right 1181568402 22:23753133-23753155 AGAGTTGAGCCACTTGGCCTGGG 0: 1
1: 0
2: 0
3: 17
4: 252
1181568390_1181568397 -6 Left 1181568390 22:23753080-23753102 CCAGGACACACCGTAGTCCCTGA 0: 1
1: 0
2: 1
3: 5
4: 106
Right 1181568397 22:23753097-23753119 CCCTGATGGTGACGTGCTGGGGG 0: 1
1: 0
2: 1
3: 8
4: 176
1181568390_1181568400 24 Left 1181568390 22:23753080-23753102 CCAGGACACACCGTAGTCCCTGA 0: 1
1: 0
2: 1
3: 5
4: 106
Right 1181568400 22:23753127-23753149 TGCAGGAGAGTTGAGCCACTTGG 0: 1
1: 0
2: 0
3: 19
4: 173
1181568390_1181568394 -8 Left 1181568390 22:23753080-23753102 CCAGGACACACCGTAGTCCCTGA 0: 1
1: 0
2: 1
3: 5
4: 106
Right 1181568394 22:23753095-23753117 GTCCCTGATGGTGACGTGCTGGG 0: 1
1: 0
2: 0
3: 7
4: 89
1181568390_1181568393 -9 Left 1181568390 22:23753080-23753102 CCAGGACACACCGTAGTCCCTGA 0: 1
1: 0
2: 1
3: 5
4: 106
Right 1181568393 22:23753094-23753116 AGTCCCTGATGGTGACGTGCTGG 0: 1
1: 0
2: 0
3: 4
4: 71
1181568390_1181568395 -7 Left 1181568390 22:23753080-23753102 CCAGGACACACCGTAGTCCCTGA 0: 1
1: 0
2: 1
3: 5
4: 106
Right 1181568395 22:23753096-23753118 TCCCTGATGGTGACGTGCTGGGG 0: 1
1: 0
2: 0
3: 8
4: 137
1181568390_1181568401 29 Left 1181568390 22:23753080-23753102 CCAGGACACACCGTAGTCCCTGA 0: 1
1: 0
2: 1
3: 5
4: 106
Right 1181568401 22:23753132-23753154 GAGAGTTGAGCCACTTGGCCTGG 0: 1
1: 0
2: 0
3: 36
4: 525
1181568390_1181568399 7 Left 1181568390 22:23753080-23753102 CCAGGACACACCGTAGTCCCTGA 0: 1
1: 0
2: 1
3: 5
4: 106
Right 1181568399 22:23753110-23753132 GTGCTGGGGGCTGAGCGTGCAGG 0: 1
1: 0
2: 4
3: 57
4: 574

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181568390 Original CRISPR TCAGGGACTACGGTGTGTCC TGG (reversed) Exonic