ID: 1181568391 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 22:23753083-23753105 |
Sequence | GGACACACCGTAGTCCCTGA TGG |
Strand | + |
Crispr in exon? | Yes |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 74 | |||
Summary | {0: 1, 1: 0, 2: 0, 3: 6, 4: 67} |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1181568389_1181568391 | -8 | Left | 1181568389 | 22:23753068-23753090 | CCGCTGCTGGTACCAGGACACAC | 0: 1 1: 0 2: 1 3: 27 4: 354 |
||
Right | 1181568391 | 22:23753083-23753105 | GGACACACCGTAGTCCCTGATGG | 0: 1 1: 0 2: 0 3: 6 4: 67 |
||||
1181568388_1181568391 | -7 | Left | 1181568388 | 22:23753067-23753089 | CCCGCTGCTGGTACCAGGACACA | 0: 1 1: 0 2: 2 3: 16 4: 189 |
||
Right | 1181568391 | 22:23753083-23753105 | GGACACACCGTAGTCCCTGATGG | 0: 1 1: 0 2: 0 3: 6 4: 67 |
||||
1181568387_1181568391 | -3 | Left | 1181568387 | 22:23753063-23753085 | CCTGCCCGCTGCTGGTACCAGGA | 0: 1 1: 0 2: 2 3: 14 4: 177 |
||
Right | 1181568391 | 22:23753083-23753105 | GGACACACCGTAGTCCCTGATGG | 0: 1 1: 0 2: 0 3: 6 4: 67 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1181568391 | Original CRISPR | GGACACACCGTAGTCCCTGA TGG | Exonic | ||