ID: 1181568391

View in Genome Browser
Species Human (GRCh38)
Location 22:23753083-23753105
Sequence GGACACACCGTAGTCCCTGA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 74
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 67}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181568389_1181568391 -8 Left 1181568389 22:23753068-23753090 CCGCTGCTGGTACCAGGACACAC 0: 1
1: 0
2: 1
3: 27
4: 354
Right 1181568391 22:23753083-23753105 GGACACACCGTAGTCCCTGATGG 0: 1
1: 0
2: 0
3: 6
4: 67
1181568388_1181568391 -7 Left 1181568388 22:23753067-23753089 CCCGCTGCTGGTACCAGGACACA 0: 1
1: 0
2: 2
3: 16
4: 189
Right 1181568391 22:23753083-23753105 GGACACACCGTAGTCCCTGATGG 0: 1
1: 0
2: 0
3: 6
4: 67
1181568387_1181568391 -3 Left 1181568387 22:23753063-23753085 CCTGCCCGCTGCTGGTACCAGGA 0: 1
1: 0
2: 2
3: 14
4: 177
Right 1181568391 22:23753083-23753105 GGACACACCGTAGTCCCTGATGG 0: 1
1: 0
2: 0
3: 6
4: 67

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181568391 Original CRISPR GGACACACCGTAGTCCCTGA TGG Exonic