ID: 1181568392

View in Genome Browser
Species Human (GRCh38)
Location 22:23753090-23753112
Sequence CACGTCACCATCAGGGACTA CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 59
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 53}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181568392_1181568400 14 Left 1181568392 22:23753090-23753112 CCGTAGTCCCTGATGGTGACGTG 0: 1
1: 0
2: 0
3: 5
4: 53
Right 1181568400 22:23753127-23753149 TGCAGGAGAGTTGAGCCACTTGG 0: 1
1: 0
2: 0
3: 19
4: 173
1181568392_1181568401 19 Left 1181568392 22:23753090-23753112 CCGTAGTCCCTGATGGTGACGTG 0: 1
1: 0
2: 0
3: 5
4: 53
Right 1181568401 22:23753132-23753154 GAGAGTTGAGCCACTTGGCCTGG 0: 1
1: 0
2: 0
3: 36
4: 525
1181568392_1181568402 20 Left 1181568392 22:23753090-23753112 CCGTAGTCCCTGATGGTGACGTG 0: 1
1: 0
2: 0
3: 5
4: 53
Right 1181568402 22:23753133-23753155 AGAGTTGAGCCACTTGGCCTGGG 0: 1
1: 0
2: 0
3: 17
4: 252
1181568392_1181568399 -3 Left 1181568392 22:23753090-23753112 CCGTAGTCCCTGATGGTGACGTG 0: 1
1: 0
2: 0
3: 5
4: 53
Right 1181568399 22:23753110-23753132 GTGCTGGGGGCTGAGCGTGCAGG 0: 1
1: 0
2: 4
3: 57
4: 574

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181568392 Original CRISPR CACGTCACCATCAGGGACTA CGG (reversed) Exonic