ID: 1181568394

View in Genome Browser
Species Human (GRCh38)
Location 22:23753095-23753117
Sequence GTCCCTGATGGTGACGTGCT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 89}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181568390_1181568394 -8 Left 1181568390 22:23753080-23753102 CCAGGACACACCGTAGTCCCTGA 0: 1
1: 0
2: 1
3: 5
4: 106
Right 1181568394 22:23753095-23753117 GTCCCTGATGGTGACGTGCTGGG 0: 1
1: 0
2: 0
3: 7
4: 89
1181568387_1181568394 9 Left 1181568387 22:23753063-23753085 CCTGCCCGCTGCTGGTACCAGGA 0: 1
1: 0
2: 2
3: 14
4: 177
Right 1181568394 22:23753095-23753117 GTCCCTGATGGTGACGTGCTGGG 0: 1
1: 0
2: 0
3: 7
4: 89
1181568389_1181568394 4 Left 1181568389 22:23753068-23753090 CCGCTGCTGGTACCAGGACACAC 0: 1
1: 0
2: 1
3: 27
4: 354
Right 1181568394 22:23753095-23753117 GTCCCTGATGGTGACGTGCTGGG 0: 1
1: 0
2: 0
3: 7
4: 89
1181568388_1181568394 5 Left 1181568388 22:23753067-23753089 CCCGCTGCTGGTACCAGGACACA 0: 1
1: 0
2: 2
3: 16
4: 189
Right 1181568394 22:23753095-23753117 GTCCCTGATGGTGACGTGCTGGG 0: 1
1: 0
2: 0
3: 7
4: 89

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181568394 Original CRISPR GTCCCTGATGGTGACGTGCT GGG Exonic