ID: 1181568399

View in Genome Browser
Species Human (GRCh38)
Location 22:23753110-23753132
Sequence GTGCTGGGGGCTGAGCGTGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 636
Summary {0: 1, 1: 0, 2: 4, 3: 57, 4: 574}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181568388_1181568399 20 Left 1181568388 22:23753067-23753089 CCCGCTGCTGGTACCAGGACACA 0: 1
1: 0
2: 2
3: 16
4: 189
Right 1181568399 22:23753110-23753132 GTGCTGGGGGCTGAGCGTGCAGG 0: 1
1: 0
2: 4
3: 57
4: 574
1181568396_1181568399 -10 Left 1181568396 22:23753097-23753119 CCCTGATGGTGACGTGCTGGGGG 0: 1
1: 0
2: 0
3: 9
4: 142
Right 1181568399 22:23753110-23753132 GTGCTGGGGGCTGAGCGTGCAGG 0: 1
1: 0
2: 4
3: 57
4: 574
1181568387_1181568399 24 Left 1181568387 22:23753063-23753085 CCTGCCCGCTGCTGGTACCAGGA 0: 1
1: 0
2: 2
3: 14
4: 177
Right 1181568399 22:23753110-23753132 GTGCTGGGGGCTGAGCGTGCAGG 0: 1
1: 0
2: 4
3: 57
4: 574
1181568389_1181568399 19 Left 1181568389 22:23753068-23753090 CCGCTGCTGGTACCAGGACACAC 0: 1
1: 0
2: 1
3: 27
4: 354
Right 1181568399 22:23753110-23753132 GTGCTGGGGGCTGAGCGTGCAGG 0: 1
1: 0
2: 4
3: 57
4: 574
1181568392_1181568399 -3 Left 1181568392 22:23753090-23753112 CCGTAGTCCCTGATGGTGACGTG 0: 1
1: 0
2: 0
3: 5
4: 53
Right 1181568399 22:23753110-23753132 GTGCTGGGGGCTGAGCGTGCAGG 0: 1
1: 0
2: 4
3: 57
4: 574
1181568390_1181568399 7 Left 1181568390 22:23753080-23753102 CCAGGACACACCGTAGTCCCTGA 0: 1
1: 0
2: 1
3: 5
4: 106
Right 1181568399 22:23753110-23753132 GTGCTGGGGGCTGAGCGTGCAGG 0: 1
1: 0
2: 4
3: 57
4: 574

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181568399 Original CRISPR GTGCTGGGGGCTGAGCGTGC AGG Exonic