ID: 1181569940

View in Genome Browser
Species Human (GRCh38)
Location 22:23763116-23763138
Sequence CTGAAGCAGCAGAACCACAG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 419
Summary {0: 1, 1: 0, 2: 5, 3: 38, 4: 375}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181569936_1181569940 14 Left 1181569936 22:23763079-23763101 CCAGGAGTCTTGGACTAGCTGCA 0: 1
1: 0
2: 0
3: 6
4: 114
Right 1181569940 22:23763116-23763138 CTGAAGCAGCAGAACCACAGAGG 0: 1
1: 0
2: 5
3: 38
4: 375

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181569940 Original CRISPR CTGAAGCAGCAGAACCACAG AGG Exonic
900906764 1:5564728-5564750 CTTAAGCAGCCCAAGCACAGTGG - Intergenic
901385387 1:8905089-8905111 CTGAGGCAGGAGAATCGCAGAGG - Intergenic
902285909 1:15408995-15409017 CTCCAGCATCAGAACCACTGGGG - Intergenic
902316522 1:15623963-15623985 CTGAAGCAGGAGAACCTGGGAGG + Intronic
902517120 1:16995544-16995566 CTGAGGCAGGAGAATCGCAGAGG - Intronic
903233489 1:21935855-21935877 CTGAAACAGGAGGACGACAGAGG + Intronic
903857315 1:26344830-26344852 ATGAGGCAGCAGGAGCACAGGGG + Exonic
903903943 1:26670014-26670036 CTGAGGCAGGAGAATCACGGAGG - Intergenic
905360044 1:37412867-37412889 CCGAGTCAGCAGATCCACAGTGG + Intergenic
905378804 1:37544958-37544980 ATGAAGCTGCAGAACCAATGAGG + Intronic
905388072 1:37618023-37618045 CTCAGGGAGCAGGACCACAGAGG + Intronic
905994694 1:42371404-42371426 CTCTAGTAGCAGAACCAGAGAGG + Intergenic
906063331 1:42962392-42962414 CTGAAGAAGTGGAATCACAGAGG + Intergenic
906149531 1:43579478-43579500 CCGAGGCAACATAACCACAGGGG - Intronic
907014256 1:50996221-50996243 CTGAAGAAAAAGAACCAGAGAGG + Intergenic
907148340 1:52257822-52257844 CTGAGGCAGGAGAACCCAAGAGG - Intronic
907348018 1:53800423-53800445 CTGAGGCAGGAGAACCAGGGAGG - Intronic
907466438 1:54640882-54640904 CTGAAGCAGCAGAAGGAGACTGG + Intergenic
907470687 1:54671566-54671588 CTGGAGAAGCAGAACCTCAGGGG + Intronic
911054239 1:93697058-93697080 GTGAAGCAGCAGGACCACCCAGG + Intronic
915677397 1:157544417-157544439 CTGAAGAAGCGGAACCGGAGCGG + Exonic
916314955 1:163438730-163438752 CTGAAACAGCAGCAGCTCAGTGG - Intergenic
916664183 1:166950499-166950521 CTGAGGCAGCAGTAACACAGGGG + Intronic
917122226 1:171654836-171654858 CTGGAGCAGCTGAGCCACAGGGG - Intergenic
919812150 1:201415475-201415497 CAGCAGCAGCAGAATCAGAGTGG - Intronic
921069352 1:211645967-211645989 CTGAGGCAGGAGAATCACAGAGG - Intergenic
921512940 1:216054452-216054474 GAGAAGCAGCAAAACAACAGAGG + Intronic
921609637 1:217195742-217195764 CTGACGCAGCAGAACCCTGGAGG + Intergenic
922846270 1:228687486-228687508 ATGAAGCTGCAGAACCAACGAGG + Intergenic
923273826 1:232379931-232379953 CAGCAGCAGAAGGACCACAGGGG - Intergenic
923907806 1:238404634-238404656 TTGCTGCAGCAGAACCACTGGGG - Intergenic
924152749 1:241145247-241145269 CTGAAGCGGGAGAATCACAGGGG - Intronic
924501292 1:244640841-244640863 CCAGAGCAGCAGAACCAGAGGGG + Intronic
1063042407 10:2356755-2356777 CTGAAGCAGGAGAATCACAGAGG + Intergenic
1063308612 10:4931648-4931670 CAGCAGCAGCAGAACCTCTGTGG + Intronic
1063318059 10:5025824-5025846 CAGCAGCAGCAGAACCTCTGTGG - Intronic
1065118080 10:22501557-22501579 CTCACGCAGTAGAATCACAGGGG - Intergenic
1065454862 10:25896524-25896546 CTGAAACAGCAGATCGACAATGG - Intergenic
1067064447 10:43095897-43095919 CTGAGGAACCAGAACCACGGTGG + Intronic
1067432458 10:46253102-46253124 CTGAAGGAGAGGAACCACCGAGG + Intergenic
1067440793 10:46308346-46308368 CTGAAGGAGAGGAACCACTGAGG - Intronic
1068097612 10:52511645-52511667 CAGCAGCAGCAGGACCAGAGAGG + Intergenic
1069129694 10:64683339-64683361 CTGAAGCAGGAGAATCACCTGGG - Intergenic
1070358815 10:75667395-75667417 CTGAGGCAGGAGAATCACTGGGG - Intronic
1071721123 10:88147186-88147208 ATGAGGCAGCAGCAGCACAGAGG + Intergenic
1073461809 10:103669967-103669989 ATGAAGAAGCTGAACCAGAGAGG + Intronic
1075214408 10:120519618-120519640 CTAATGCACCAGAACCTCAGAGG - Intronic
1076816895 10:132919535-132919557 TTGAAACTGCAGAGCCACAGTGG - Intronic
1077196991 11:1286084-1286106 TGGAAGCAGCTGAAACACAGCGG + Exonic
1077383271 11:2257342-2257364 CTGGGCCAGCAGAACCACAGCGG - Intergenic
1077578272 11:3400716-3400738 CAGAAGCCTGAGAACCACAGGGG - Intergenic
1079145082 11:17843873-17843895 CTAAAACATCAGAACCAGAGGGG + Intronic
1079429718 11:20377580-20377602 TTTAAGCAGCAGAGCCACAGAGG + Intronic
1080641145 11:34159104-34159126 CTGAAGCTGCAGCCCCACAACGG + Intronic
1082097114 11:48139822-48139844 CTGGAGCGGCTGACCCACAGTGG + Intronic
1083160122 11:60849522-60849544 CTGCAGCAGCAGGACTCCAGGGG + Intronic
1083342122 11:61965397-61965419 ATGAAGCTGCAGAACCAACGAGG - Exonic
1084235261 11:67783918-67783940 CAGAAGCCTGAGAACCACAGGGG - Intergenic
1084310984 11:68316142-68316164 CAGAACAGGCAGAACCACAGAGG - Intronic
1085588533 11:77734794-77734816 ATGAAGCTGCAGAACCAACGAGG - Intronic
1086539427 11:87890390-87890412 CTTAAGCAGCAGAAGAACATAGG - Intergenic
1086731990 11:90262273-90262295 CTGAAGCATTAGATCCACATTGG + Intergenic
1088560070 11:111105707-111105729 CTGAAGAAGCAGATTCACAGGGG - Intergenic
1088590410 11:111398102-111398124 CTAAAGCGGCAGCAACACAGTGG - Intronic
1089134051 11:116235239-116235261 CTGAGCCAGCAAGACCACAGAGG - Intergenic
1089166228 11:116478694-116478716 CTTCAGCAGCAGAATCTCAGAGG + Intergenic
1091602215 12:1924893-1924915 CTGAAGCAGAAGAAACTCAGAGG + Intergenic
1093092456 12:14936989-14937011 CTGAAGGAGCAGAATAAGAGAGG - Intronic
1093707227 12:22288010-22288032 CTGAAGCACCAGCATCACTGGGG + Intronic
1094219027 12:27973913-27973935 CTGAAGCAGGAGGCCCAGAGAGG + Intergenic
1094441762 12:30485633-30485655 CTGGAGCTGAGGAACCACAGAGG - Intergenic
1094557403 12:31514896-31514918 CTGAAGCAGGAGAATCACTTTGG + Intronic
1094670563 12:32564180-32564202 CACAAGCAGCACAACCACACTGG + Exonic
1096320584 12:50609041-50609063 CTGAAGCAGGAGAATCATGGAGG + Intronic
1096363063 12:51004860-51004882 CTGGAGCAGCAGCCCCACAAGGG + Exonic
1097440330 12:59599943-59599965 CCCAAGCAGCAGCTCCACAGAGG - Intronic
1101311125 12:103580314-103580336 ATGAAGCAGAGGAACCAGAGAGG + Intergenic
1101315085 12:103621631-103621653 CTGAAGCAGGAGAACCTGGGAGG + Intronic
1101922996 12:108948014-108948036 CTGAAGCTGCATCACCCCAGAGG + Intronic
1102291240 12:111701926-111701948 GTGAAGCATCAGATCCTCAGTGG - Intronic
1103887991 12:124217144-124217166 CTCAAGCAGGAGGACCACTGGGG - Intronic
1104325950 12:127798609-127798631 CTAAAGCAACAGAACCAAAAAGG - Intergenic
1104866873 12:131961102-131961124 CTGCAGCAGCAGCCCTACAGGGG + Exonic
1104885423 12:132104470-132104492 CTGCAGCAGCAGCCCTACAGGGG + Exonic
1105268308 13:18843804-18843826 CTGTAGCAGCAGAAATACTGTGG + Intergenic
1106147565 13:27063795-27063817 CTGCAGTAGCACAATCACAGTGG - Intergenic
1106165945 13:27246570-27246592 CTGAAGCAGGAGAATCACTTGGG - Intergenic
1106292626 13:28379242-28379264 CTGAAGCACCAGAACCTGGGAGG + Intronic
1110618749 13:77571288-77571310 CTGAGGCAGCAGAATCGCGGAGG + Intronic
1111425363 13:88073130-88073152 ATGAAGTAGGAGAACCAGAGTGG - Intergenic
1111735590 13:92135050-92135072 CTGCAGCAGGAGAACCAGAGAGG - Intronic
1113788801 13:113016595-113016617 CGGGGGCAGCAGTACCACAGGGG - Intronic
1114302756 14:21393136-21393158 CTGCAGTAGCAGAAGCTCAGGGG + Exonic
1114540292 14:23450531-23450553 CTGAAGCAGGAGAATCACTTGGG + Intergenic
1116347733 14:43816702-43816724 CTGAGGCAGCAGAACACCTGAGG + Intergenic
1118128824 14:62939286-62939308 CTGAAGAAGGAGAGCCACAGAGG - Intronic
1118370666 14:65134931-65134953 CTGAAGTAGGAGAACCTCTGTGG + Intergenic
1118970057 14:70628613-70628635 CTGAGGCAGGAGAACCCAAGAGG + Intergenic
1120377536 14:83729283-83729305 CTGTACCTGCAGAGCCACAGAGG - Intergenic
1121612753 14:95292851-95292873 CTGGAGGAGCAGACCCACACCGG - Intronic
1122852831 14:104546189-104546211 CTGAAGCAGCGGAATCACCCTGG + Intronic
1122977066 14:105175114-105175136 CTGTACCAGTAGAACCACCGCGG + Intronic
1123025960 14:105424151-105424173 CTGAGGCAGGAGAAGCTCAGTGG - Intronic
1123027212 14:105431722-105431744 CTGAAGCAGGAGAATCACTCGGG - Intronic
1202831004 14_GL000009v2_random:30190-30212 CTGTAGCAGCAGAAATACTGTGG - Intergenic
1123675190 15:22703730-22703752 CTGTAGCAGGAGACCCAGAGAGG - Intergenic
1123878395 15:24649487-24649509 CTGAGGCAGCAGCACTGCAGAGG - Intergenic
1123909344 15:24951253-24951275 GTGAAACAGCACAGCCACAGTGG - Intronic
1123929273 15:25153006-25153028 CTGAAGAAGCACAAAGACAGAGG + Intergenic
1124769470 15:32519076-32519098 CTGCAGCAGGAGAACGAGAGAGG + Intergenic
1124923362 15:34047616-34047638 CTGAGTCAACTGAACCACAGAGG - Intronic
1127063830 15:55216053-55216075 ATGAAGCAGCGGAGGCACAGAGG - Intronic
1130296552 15:82650426-82650448 CAGAAGCAGCAGAAACAAATAGG + Intergenic
1131045828 15:89314768-89314790 CTGAAGCAGCACAACTACAATGG + Intronic
1131168317 15:90158833-90158855 CTGAAGCAGAAAAGCCAGAGGGG - Intergenic
1131190161 15:90308361-90308383 CTGAACCTGCAGAGCTACAGAGG + Intronic
1131389031 15:92032330-92032352 TTGAGGATGCAGAACCACAGAGG + Intronic
1132032858 15:98452524-98452546 CTGCTGCAGCAGAGCCAGAGAGG + Intronic
1132062550 15:98704372-98704394 CTGAAGGAGCAGAAGCACTGTGG + Intronic
1132118429 15:99156170-99156192 CTGGCGCAGGGGAACCACAGTGG - Exonic
1132996669 16:2827139-2827161 CTCAGGCTGCAGAGCCACAGAGG + Intergenic
1133279362 16:4656313-4656335 CTGAATCAGTAAAACCAAAGCGG + Intronic
1133803266 16:9102020-9102042 CTGAAGCAGGAGAACCCTGGAGG + Intronic
1134635350 16:15787570-15787592 CTGAGGCAGGAGAACCAGGGAGG - Intronic
1135330560 16:21556519-21556541 CTGAAGCAGCAGATCCCCTGAGG - Intergenic
1136025516 16:27465780-27465802 CTTGAGCAGGAGAATCACAGTGG - Intronic
1136344714 16:29667195-29667217 CTGCAGCTGCAGAATGACAGAGG + Exonic
1138158292 16:54726960-54726982 CTGAAGCAGCTGACCCAATGTGG + Intergenic
1138474457 16:57262634-57262656 CTGAAGCAGGAGGATCACATGGG + Intronic
1139292499 16:65871270-65871292 CAGAGGCAGCAGAATCACTGGGG + Intergenic
1139747883 16:69089033-69089055 CTGAAACAACAGAGCCACCGAGG - Intergenic
1139926022 16:70487190-70487212 CTGAGGCAGGAGAATCGCAGAGG + Intronic
1139940375 16:70601220-70601242 CTGAGGCAGCACATGCACAGAGG - Intronic
1139961224 16:70718635-70718657 CTGAGCCAGGAGAACCACAGGGG - Intronic
1141160149 16:81624010-81624032 CTGTATCAGCAGAAGCAGAGGGG - Intronic
1141890644 16:86924508-86924530 CTGAAGCTGCAGACCACCAGTGG - Intergenic
1142583877 17:958670-958692 CTGAGGCAGGAGAATCACCGAGG + Intronic
1142842648 17:2645701-2645723 CTGAGGCAGGAGAACCCAAGAGG - Intronic
1143434349 17:6912614-6912636 GTGAAGCAGCAGTATCACGGGGG + Intronic
1143848060 17:9788147-9788169 CTGAAGCAGCTCAACTGCAGGGG + Intronic
1144404901 17:14942786-14942808 CTCACCCAGCATAACCACAGAGG + Intergenic
1145777554 17:27539928-27539950 GAGATGCAGCAGAACCAAAGAGG - Intronic
1146078985 17:29760476-29760498 CAGAAACAGCTAAACCACAGTGG + Intronic
1146502100 17:33373002-33373024 CCAAAGCATCAGAACCCCAGGGG - Intronic
1146648532 17:34591677-34591699 CTGAAGGAGCGGATCCACACAGG + Intronic
1147878690 17:43639848-43639870 CTGAGGCAGGAGAACCCAAGAGG + Intergenic
1148385995 17:47235561-47235583 TTGAAACAGCATAAGCACAGGGG - Intergenic
1148581558 17:48747456-48747478 GGGAAGCAGCGGACCCACAGGGG + Intergenic
1148810374 17:50286573-50286595 CTGAGGCAGGAGGACCTCAGAGG + Intergenic
1148897107 17:50845410-50845432 CTGGATCAGCACAAACACAGAGG - Intergenic
1150490106 17:65568529-65568551 CTGAAGCAGGAGAATGACATGGG - Intronic
1150559188 17:66280500-66280522 CTGAGGCAGGAGAACCCGAGAGG - Intergenic
1150788069 17:68178596-68178618 CTGAGGCAGGAGAACCCCGGAGG + Intergenic
1151231543 17:72688703-72688725 ATGTAGCAGCAGGACCTCAGGGG + Intronic
1153745972 18:8180059-8180081 TTGGAAGAGCAGAACCACAGTGG + Intronic
1153876038 18:9371862-9371884 CTGAGGCAGGAGAATCACCGGGG - Intronic
1154419711 18:14216230-14216252 CTGTAGCAGCAGAAATACTGTGG - Intergenic
1155779388 18:29811786-29811808 CAGCAGCAGCAGTAGCACAGTGG - Intergenic
1157682586 18:49618586-49618608 CTCAAGTAGCAGAACCACTCAGG - Intergenic
1157827459 18:50824974-50824996 CTGAGGCAGGAGAACCACCTGGG + Intronic
1158180062 18:54704691-54704713 CTGAAGAATCAGTATCACAGAGG - Intergenic
1158514043 18:58116427-58116449 CTGATGCAGCAGATCTGCAGAGG - Intronic
1158664908 18:59423681-59423703 CTGTAGCATCACAACCACACTGG - Intergenic
1158969113 18:62650073-62650095 CTGAAGCTGCAGAACTACTCAGG - Intergenic
1158984584 18:62801145-62801167 CTGAGGCAGGAGAATCACTGGGG - Intronic
1161686076 19:5703310-5703332 CTGAGTGAGCAGAACCACAGAGG + Intronic
1162542498 19:11306167-11306189 CTGAGGCAGGAGAATCACTGAGG + Intronic
1162983052 19:14251188-14251210 CTGAGGCAGGAGAATCGCAGAGG - Intergenic
1164556703 19:29258623-29258645 CTGAACCAGCAGAACCACTGGGG - Intergenic
1165402201 19:35608884-35608906 CTGAAGGAGCAGAGCCCCTGTGG - Intergenic
1165438480 19:35810167-35810189 CTGAAGCAGGAGAACCCGGGAGG + Intronic
1165452258 19:35890416-35890438 CAGCAGCAGCTGAACCAGAGTGG + Exonic
1167022545 19:46888908-46888930 CTGAGGCAGGAGAATCACTGGGG + Intergenic
1168250400 19:55138197-55138219 CAGAACCAGCAGAAACGCAGGGG + Intronic
925227131 2:2193057-2193079 CTGAGGCAGGAGAATCACTGAGG - Intronic
925227133 2:2193074-2193096 CTGAGGCAGGAGAATCACTGAGG - Intronic
929889341 2:45906368-45906390 CTGCAGCTGAAGATCCACAGGGG - Intronic
931256029 2:60573677-60573699 CTGATGTAGCTGAAGCACAGTGG + Intergenic
932239630 2:70146523-70146545 ATGACTCAGAAGAACCACAGGGG - Intergenic
932713275 2:74083244-74083266 CTGAAGGCTCAGAACAACAGAGG + Intronic
932893055 2:75612527-75612549 CAGAAGCAGCAGAAACTAAGAGG - Intergenic
933764487 2:85697483-85697505 CTGCAGCAGCAGCACCACAGTGG - Intronic
934497517 2:94821034-94821056 CTGTAGCAGCAGAAATACTGTGG + Intergenic
934673137 2:96229612-96229634 CTGAAGCAGGAGGACCACTGGGG - Intergenic
934979187 2:98826201-98826223 CTGAGGCAGCACACCCAAAGAGG + Intronic
935353942 2:102180752-102180774 CTGAAGTTGTATAACCACAGAGG + Intergenic
935825021 2:106937316-106937338 CTAAAGAAGCAGAAGCACAGAGG + Intergenic
936351415 2:111715506-111715528 GTGATGCAGATGAACCACAGTGG - Intergenic
936791516 2:116158519-116158541 CTGAGGCAGGAGAATCACTGTGG - Intergenic
937024073 2:118682873-118682895 CAGCAGCAGCAGCAGCACAGAGG - Intergenic
937097345 2:119243949-119243971 CTGAAGCAGCAGAGCAGCTGGGG - Intronic
937476221 2:122217820-122217842 AGGCAGGAGCAGAACCACAGCGG - Intergenic
937685247 2:124689052-124689074 CTGAAGCAGGAGAATGGCAGGGG - Intronic
938780653 2:134581814-134581836 AAGAAGCAGCAGAACCAAAAAGG + Intronic
940050185 2:149454259-149454281 ATGAAGCAATAGAACCCCAGAGG + Intronic
941270027 2:163413996-163414018 CTGAAGCAGCAGCTCCCCAGGGG + Intergenic
941445192 2:165591608-165591630 CTGAAGCAGCTGGGACACAGGGG - Intronic
941686112 2:168450761-168450783 CTGAGGCAGGAGAACCACCTGGG + Intergenic
942635000 2:177994027-177994049 CTGAAGCAGCAGAATCGCTCGGG - Intronic
942882127 2:180873182-180873204 ATGAAGCTGCAGAACCAATGAGG - Intergenic
943248403 2:185485141-185485163 CTGTACCTGCAGAGCCACAGGGG + Intergenic
945357425 2:208856762-208856784 CTGCAGCAGCAGTAGCAGAGGGG + Intergenic
946426535 2:219601379-219601401 CTGAAGCTGAAGAATAACAGGGG - Exonic
947010797 2:225564192-225564214 CTGAAGAGTCAGGACCACAGTGG - Intronic
948755973 2:240159708-240159730 CTGAAGCATCAGAAACGTAGGGG + Intergenic
949070318 2:242020560-242020582 CTGCAGCTGCAGACCCAGAGAGG + Intergenic
1169438713 20:5616110-5616132 CTGAAGCAGCAGATCACCTGAGG - Intergenic
1169975099 20:11316419-11316441 CTGAATCAGCATCACCAGAGTGG - Intergenic
1170938609 20:20830380-20830402 CTGAACCTGCAGAGCCACAGGGG + Intergenic
1171406791 20:24917172-24917194 CTAAAGCAACTGAACCAAAGTGG + Intergenic
1171467856 20:25343703-25343725 CTGAAGCAGGAGAACCTGGGAGG + Intronic
1172054750 20:32146434-32146456 CTGAAGCAGCAGATAGCCAGAGG + Intronic
1172526755 20:35604427-35604449 CTGAATCGGCAGATCCAGAGTGG + Intergenic
1172567648 20:35943247-35943269 CTGAAGCAGCAGAATCTAGGAGG + Intronic
1172611793 20:36257929-36257951 CTGAAGCAGCAAATCCAGATGGG + Intronic
1172757572 20:37297615-37297637 GTGAAGCAGCAGAGCCAAGGTGG + Intronic
1173466085 20:43282497-43282519 CTGGAGCAGAAGAAACAAAGAGG + Intergenic
1174420391 20:50395601-50395623 CTGGAGAAGCAGAACCACCCTGG - Intergenic
1175626733 20:60494723-60494745 CTCAAGCCCCAGCACCACAGAGG + Intergenic
1175715950 20:61253920-61253942 CTGAAGGAGCAGGAGCACAGCGG - Intronic
1176084156 20:63288456-63288478 CTGATGCAGGGGAGCCACAGAGG - Exonic
1176610192 21:8875029-8875051 CTGTAGCAGCAGAAATACTGTGG - Intergenic
1176853584 21:13943067-13943089 CTGTAGCAGCAGAAATACTGTGG + Intergenic
1177893836 21:26838204-26838226 GTGAAACAGCGGAACCAGAGGGG - Exonic
1178174786 21:30083973-30083995 CTGAAGCAAGAGAAACACTGTGG + Intergenic
1178419045 21:32428918-32428940 CAGAAGCCTGAGAACCACAGGGG + Intronic
1179085106 21:38209182-38209204 CTGGAGCAGCAGGAGCAAAGGGG + Intronic
1179433228 21:41339955-41339977 CTAAAGCCTCAGAACCAGAGAGG + Intronic
1179479579 21:41668924-41668946 CTGGCTCAGCAGACCCACAGGGG - Intergenic
1180257109 21:46637853-46637875 CTGAAGCAGGAGAATCACTTGGG + Intronic
1180956124 22:19742163-19742185 CTGAGGCAGGAGGACCTCAGGGG - Intergenic
1181569940 22:23763116-23763138 CTGAAGCAGCAGAACCACAGAGG + Exonic
1181622568 22:24101054-24101076 CTGAAGCAGCAGCTCCTGAGTGG + Intronic
1181894029 22:26090954-26090976 CTGAAGCAGCAGACCCAGAAGGG - Intergenic
1182907400 22:33950013-33950035 CTGAAGAAGGAGAAACAGAGGGG - Intergenic
1183711557 22:39507048-39507070 CTTATGCAGCAGAACCTGAGTGG + Intronic
1183890532 22:40924245-40924267 CTGAAGTGGCAGAACCATGGGGG + Intronic
1184388447 22:44189296-44189318 CTGAAGCAGAAGGACCCCAGCGG - Intronic
1184517277 22:44970464-44970486 CTGTAGCAGCAGACCTAGAGGGG - Intronic
1184798935 22:46748485-46748507 GTGAAGCAGCCTGACCACAGAGG - Intergenic
1184970379 22:48015847-48015869 CTGAAGCTGCTGACCCAGAGAGG - Intergenic
1185373042 22:50469679-50469701 CGGAAGCAGCAGAGCCAGATGGG + Intronic
949159153 3:859560-859582 GTGCAGCAGAAGACCCACAGAGG - Intergenic
950247819 3:11438141-11438163 CTGGAGCAGCAGGACCTCAGGGG - Intronic
950645498 3:14374350-14374372 CTGAAACAGATAAACCACAGGGG + Intergenic
950971502 3:17193179-17193201 CTGAAGCAGCACAATCAGCGAGG - Intronic
952456612 3:33478524-33478546 CTGAGGCAGGAGGACCACTGGGG + Intergenic
952782674 3:37118294-37118316 CTGATGCAGCAGAATCACCCAGG - Intronic
952892839 3:38054850-38054872 GTAAGTCAGCAGAACCACAGCGG + Intronic
953684074 3:45062444-45062466 CTGAGGCGGCAGAATCACATGGG - Intergenic
954783932 3:53079633-53079655 CTGAGGCAGGAGAATCGCAGAGG + Intronic
954871285 3:53769269-53769291 GTGGAGCTGCTGAACCACAGGGG + Intronic
956521551 3:70109528-70109550 ATGAAACTGCAGAACCTCAGAGG - Intergenic
958833630 3:99118363-99118385 CTGAAACTGCAGAACCAGTGTGG - Intergenic
960738499 3:120806392-120806414 AAGAAGCAGCAGAAACACAAGGG + Intergenic
961349699 3:126292030-126292052 CTGAAACAGTAAAACCACAGAGG + Intergenic
961410776 3:126718799-126718821 CTGCACCAACAGAACCAGAGGGG - Intronic
961763585 3:129190137-129190159 CTGAGGCAGGAGAATCAGAGCGG + Intergenic
961884916 3:130090449-130090471 CAGAAGCCTGAGAACCACAGGGG - Intronic
962695945 3:137947449-137947471 ATGAAGAAACAGAAGCACAGAGG - Intergenic
963145361 3:141988502-141988524 CTGAGGCAGGAGAACTAGAGGGG - Intronic
963286661 3:143440300-143440322 CTCAAGCAGCATTAGCACAGTGG - Intronic
965659709 3:171028540-171028562 GAGAAAGAGCAGAACCACAGAGG - Intergenic
966925441 3:184641628-184641650 CTGAGGCAGCAGAATCGCTGAGG - Intronic
967602382 3:191405257-191405279 CTGCACCAGCAAATCCACAGGGG - Intergenic
968073017 3:195799397-195799419 CTGAAGCAGGAGAATCACGGAGG - Intronic
1202736873 3_GL000221v1_random:9816-9838 CTGTAGCAGCAGAAATACTGTGG - Intergenic
968627257 4:1631552-1631574 CTGAAGGCGCCCAACCACAGAGG + Intronic
968879248 4:3290765-3290787 CTACAGGAGGAGAACCACAGGGG + Intergenic
968946247 4:3665951-3665973 CTGGAGCTGCAGGAGCACAGAGG + Intergenic
968994059 4:3934406-3934428 CAGAAGCCTGAGAACCACAGGGG - Intergenic
969819874 4:9711837-9711859 CAGAAGCCTGAGAACCACAGGGG + Intergenic
974035573 4:56814990-56815012 CTGAGGCAGGAGAATCACACAGG + Intronic
974672499 4:65050471-65050493 CTGAAGCAGGAGAAGGACTGCGG - Intergenic
975671744 4:76787270-76787292 CTGAAGCAGCACAGCCCCTGGGG + Intergenic
975678650 4:76852825-76852847 CTGAAGCAGGAGAATCACTTGGG + Intergenic
976347940 4:84026666-84026688 CTGAAGCAGAAGAACTGAAGGGG - Intergenic
976384873 4:84445240-84445262 CTGAGGAAGCAAAACCACACTGG + Intergenic
977696577 4:99972237-99972259 CAGAGGCAGCAGCAGCACAGGGG - Intergenic
978261831 4:106768873-106768895 CTGACGCAGCAGAGTCATAGTGG + Intergenic
980261235 4:130450484-130450506 CAGAAGAAGCAGAACTAAAGTGG + Intergenic
980508233 4:133751649-133751671 CTCAAACAGCAAAATCACAGTGG + Intergenic
981236881 4:142427654-142427676 CTGAAGCAGCAGAAGCAATTAGG - Intronic
981263388 4:142750667-142750689 CTGGTGCAGCATAAACACAGAGG + Intronic
981308702 4:143273979-143274001 CTGATTCAGCAAAACCATAGTGG + Intergenic
982489145 4:156006660-156006682 ATGAAGCTGCAGAACCAACGAGG + Intergenic
982878239 4:160674587-160674609 CTGATGAAGAATAACCACAGGGG + Intergenic
983309868 4:166045792-166045814 CTGAGGCAGCGGAACATCAGTGG - Intronic
983412665 4:167419546-167419568 CTGGATCAGCAGAGCCACTGAGG - Intergenic
983844309 4:172497717-172497739 CTGAAGCTGAAGAATCACTGTGG + Intronic
984304980 4:177977462-177977484 ATGAAGCAGCACAATCACTGGGG - Intronic
985201480 4:187489172-187489194 CTGTACCTGCAGAGCCACAGGGG + Intergenic
985271029 4:188195421-188195443 AAGAAGCAGCAGAGACACAGGGG + Intergenic
986032059 5:3904294-3904316 ATGAGGCTGCAGAATCACAGAGG + Intergenic
986230717 5:5862724-5862746 CTGAGGCAGGAGAATCACAGAGG - Intergenic
986392666 5:7300591-7300613 CTGAAGCAGAAGAAGCAGATGGG - Intergenic
987128984 5:14842968-14842990 ATCCAACAGCAGAACCACAGTGG - Intronic
987388615 5:17354192-17354214 ATGAAGCTGCAGAACCAAGGAGG - Intergenic
988539279 5:32094778-32094800 CTGAAGCAGGAGAATCACTTGGG + Intronic
988772984 5:34450444-34450466 CTGATATAGCAGACCCACAGGGG - Intergenic
988928579 5:36013723-36013745 CTCAAACAGCAGCCCCACAGGGG + Intergenic
991181545 5:63756971-63756993 CTGAAGTTTGAGAACCACAGGGG + Intergenic
991958210 5:72016738-72016760 TTGAAGAATCAGATCCACAGTGG - Intergenic
992097256 5:73374279-73374301 CTGAAGCAGCAAAATTACTGTGG + Intergenic
992579630 5:78158356-78158378 CTGAAGCAGGAGAATCACCTGGG + Intronic
994803369 5:104409722-104409744 CTGAAGCAGCTGAAACTCATAGG + Intergenic
995604351 5:113835373-113835395 CTGCAGCAGTAAAATCACAGGGG + Intergenic
995917375 5:117264530-117264552 CTGAATCAGCAGAAAAACAATGG + Intergenic
996249651 5:121313938-121313960 CTGAAAAAACAGAACCAGAGAGG - Intergenic
997359179 5:133283561-133283583 CTGGGGCAGCAGATCCCCAGGGG + Intronic
998017999 5:138747868-138747890 CTGAGGCAGCAGGATCACTGAGG + Intronic
998813477 5:145989181-145989203 CTGAATCAGCAAAATCACACAGG - Intronic
999257012 5:150215349-150215371 GTGAAGCAGCAGATTCAGAGGGG - Intronic
999269493 5:150288605-150288627 CTGAGGCAGCAGGAGCACGGGGG - Intronic
999377755 5:151098556-151098578 CTTAAGCACCAGAACCACATTGG + Intergenic
1000326068 5:160173403-160173425 CAGATGCAGCAGCCCCACAGAGG + Intergenic
1000698796 5:164422215-164422237 CTGCAGCAGCAGGGGCACAGGGG + Intergenic
1001131196 5:169065048-169065070 TTGAAGAACCAGAAGCACAGAGG + Intronic
1002398077 5:178973206-178973228 CTGAAGCAGCAAGACCACACAGG + Intergenic
1003564920 6:7214709-7214731 CAGAGGCAGCAGAACCACAGTGG + Intronic
1004013462 6:11711127-11711149 CTTGAGGAGCAGCACCACAGGGG - Intergenic
1004477431 6:15986855-15986877 CGGAAGAAGCAGAGACACAGAGG + Intergenic
1005103805 6:22201602-22201624 CTAAAGCAACAAAACCATAGTGG - Intergenic
1005679099 6:28187955-28187977 GTGAAGTAACAGAACCACATAGG + Intergenic
1006171400 6:32095464-32095486 CAGGGGCAGCAGAACCACAGGGG - Intronic
1006723201 6:36173972-36173994 CTGAAGATTCAGAACCTCAGAGG + Intergenic
1006750212 6:36372305-36372327 CTGGAGCAGCAGGAGCACGGGGG + Intronic
1007215292 6:40232700-40232722 CTGAAAGAGAAGAACCCCAGAGG + Intergenic
1007389367 6:41541433-41541455 ATGGAGCAGAAGAACCACAGGGG + Intergenic
1008251951 6:49251062-49251084 CTGAGGCAGGAGAATCCCAGTGG + Intergenic
1008924602 6:56878552-56878574 GTGAAGCATCAGAAGCTCAGAGG + Intronic
1009390734 6:63140358-63140380 CGGTAGCAGCACAGCCACAGAGG + Intergenic
1011165734 6:84443911-84443933 ATGAAGAAGCAGAAACTCAGGGG + Intergenic
1011634962 6:89363015-89363037 CTGAAGCAGGAGAATCACTTGGG + Intergenic
1012862676 6:104579562-104579584 GTGAAGCTGCAGAGCCAGAGGGG - Intergenic
1013670256 6:112394010-112394032 ATGAAGCTGAAGAACCACAGAGG - Intergenic
1013734491 6:113209544-113209566 CTCAGGCACCAGAGCCACAGAGG - Intergenic
1013900051 6:115144265-115144287 CTGAAGCAGAAGAATCAGAGAGG + Intergenic
1014339628 6:120187864-120187886 CTCAAACATCAGAACCACTGTGG - Intergenic
1015277521 6:131399555-131399577 CAGAATCAGCAGATTCACAGAGG + Intergenic
1015388279 6:132651157-132651179 GTGAGATAGCAGAACCACAGCGG - Intergenic
1015395691 6:132732051-132732073 CTGAAGCAGGAGGATCACTGGGG - Intronic
1016361761 6:143275000-143275022 AGGAAGCAGCATAAACACAGAGG + Intronic
1017509537 6:155101798-155101820 CTGAGGCAGGAGAACCCGAGAGG - Intronic
1017746918 6:157455456-157455478 ATGAAGCAGGTGAACCACATGGG + Intronic
1017869352 6:158473751-158473773 CTGAAGCAGGAGAATCAGTGAGG - Intronic
1020318289 7:6922466-6922488 CAGAAGCCTGAGAACCACAGGGG - Intergenic
1020760429 7:12262043-12262065 CAGAAGCAGCAGAAGAAAAGTGG + Intergenic
1021900991 7:25285403-25285425 CTAATGCAGCAGAATCCCAGGGG - Intergenic
1022163070 7:27731388-27731410 CAGAAGAAGCAGAAACAGAGAGG - Intergenic
1023085343 7:36564724-36564746 TTGAAACAGCACAACTACAGAGG - Intronic
1025250584 7:57348889-57348911 CTGGAGAAGCAGAACCACCCTGG + Intergenic
1026769772 7:73188218-73188240 CAGAAGCAGTGGAACCAAAGAGG - Intergenic
1027010640 7:74741600-74741622 CAGAAGCAGTGGAACCAAAGAGG - Intronic
1027077402 7:75204440-75204462 CAGAAGCAGTGGAACCAAAGAGG + Intergenic
1028728381 7:94115960-94115982 CTGAAGGAGCAGTTCCAAAGGGG + Intergenic
1029130319 7:98325282-98325304 CTGAGGCAGGAGAACTGCAGAGG + Intronic
1032572351 7:133013377-133013399 ATGAAGTAGCCGAAACACAGAGG - Intronic
1034468462 7:151243467-151243489 GGGAAGCAGCAGAGCCACTGGGG - Intronic
1035058406 7:156051794-156051816 CTGAAGCAAGGGAGCCACAGAGG + Intergenic
1035366329 7:158351216-158351238 CTGAAGGGGCAGAACCCCTGGGG - Intronic
1036382040 8:8242192-8242214 CAGAAGCCTGAGAACCACAGGGG + Intergenic
1037236553 8:16727226-16727248 CTGAGGCAGGAGAATCACGGAGG - Intergenic
1037581962 8:20250695-20250717 CTGAGGCAGGAGAATCAGAGGGG - Intronic
1037665585 8:20966885-20966907 CTTAACCAACAAAACCACAGTGG + Intergenic
1037763959 8:21760329-21760351 CTGAAGCAGCAGAAAGCTAGTGG + Intronic
1038361697 8:26885921-26885943 CTGAAGCAGGAGAAATTCAGAGG + Intergenic
1039776580 8:40743582-40743604 GTGACGCAGGAGGACCACAGCGG + Intronic
1042792473 8:72623838-72623860 GTGAAGCATCAGACCCACTGAGG + Intronic
1043563439 8:81521999-81522021 ATGAAGCTGCAGAACCAACGAGG - Intergenic
1043837008 8:85060073-85060095 CTTTAGCAGCAGAACCACATGGG - Intergenic
1044201883 8:89448087-89448109 AAGAAGCAGGAGCACCACAGAGG - Intergenic
1044305961 8:90641665-90641687 CTGAAGCAGTTGAGGCACAGTGG - Intronic
1045674963 8:104597447-104597469 GAGATACAGCAGAACCACAGGGG + Intronic
1047869924 8:129071388-129071410 CTGAAGCAGCTGAGACACAGGGG - Intergenic
1048912871 8:139152854-139152876 CAGAAACAGCAGCAGCACAGAGG - Intergenic
1049791080 8:144473029-144473051 CTGCAGCAGCAGCACCGCGGTGG - Exonic
1050084223 9:1947729-1947751 CTGAAGCAATAGTACCATAGGGG - Intergenic
1050257424 9:3809881-3809903 CTGAGGCATGAGAACCACAATGG - Intergenic
1050354526 9:4770182-4770204 CTGAGGCAGGAGAATCACTGAGG + Intergenic
1051157488 9:14166734-14166756 CAGAAGCAGAGGAAACACAGAGG - Intronic
1051190882 9:14510955-14510977 CTGAAGCAGCATCATCAAAGAGG - Intergenic
1051289078 9:15527451-15527473 TTGAAGCTGCAGAACCAACGAGG - Intergenic
1053659628 9:40259437-40259459 CTGTAGCAGCAGAAATACTGTGG - Intronic
1053909999 9:42888789-42888811 CTGTAGCAGCAGAAATACTGTGG - Intergenic
1054360640 9:64112188-64112210 CTGTAGCAGCAGAAATACTGTGG - Intergenic
1054371756 9:64405736-64405758 CTGTAGCAGCAGAAATACTGTGG - Intronic
1054524970 9:66116779-66116801 CTGTAGCAGCAGAAATACTGTGG + Intronic
1054679375 9:67895453-67895475 CTGTAGCAGCAGAAATACTGTGG - Intronic
1056795989 9:89659346-89659368 CTGAAGCAACAGGACCACAGAGG - Intergenic
1056972095 9:91213640-91213662 CTGAAGCCAAAGAACCAAAGCGG - Intergenic
1057986028 9:99715087-99715109 CTGAAGCAGGAGAACCTGGGAGG - Intergenic
1058111360 9:101033762-101033784 CTGAAGCAGCTGAAACAGAGAGG + Intronic
1058421058 9:104833870-104833892 CTCAATCAGCAGATCCAGAGGGG + Intronic
1059173373 9:112147405-112147427 CTGAGACAGGAGAAGCACAGGGG + Intronic
1059226186 9:112675225-112675247 CTGAGGCAGCAGAATCTAAGAGG - Intergenic
1059472183 9:114514005-114514027 CTGAGGAAACAGAACCAGAGGGG - Intergenic
1060394337 9:123305086-123305108 ATGAGGCAGCAGAAGCACAGAGG + Intergenic
1060648903 9:125307164-125307186 CTGAGGCAGGAGAATCACAGTGG + Intronic
1061673144 9:132200596-132200618 TGGAAACAGCAGCACCACAGCGG - Intronic
1062039959 9:134400002-134400024 CAGAGGCAGCAGGAACACAGAGG - Intronic
1062090099 9:134671567-134671589 CTGAGTCAGCAGAGCCAGAGAGG + Intronic
1203776617 EBV:76742-76764 CTGAAGCAACAGGTCCTCAGAGG + Intergenic
1203705598 Un_KI270742v1:40260-40282 CTGTAGCAGCAGAAATACTGTGG - Intergenic
1187222406 X:17341100-17341122 CTGAAGCAGCAAAAAAAGAGAGG + Intergenic
1187349423 X:18498866-18498888 CTGAGGCACGAGAATCACAGAGG - Intronic
1188269396 X:28120105-28120127 CTGAAGAAACCAAACCACAGAGG - Intergenic
1190344025 X:49321587-49321609 TTGTAGCATCAGAATCACAGAGG - Intergenic
1193697163 X:84723499-84723521 CTGAACCAGCACAATCATAGTGG - Intergenic
1194249626 X:91559011-91559033 GTGAATCAGTAAAACCACAGTGG + Intergenic
1194482635 X:94445759-94445781 CTCAAGCAACAAAACCACATGGG - Intergenic
1194595259 X:95848863-95848885 CTGACCCAGCAGAGTCACAGTGG + Intergenic
1194972339 X:100357970-100357992 CTGAAGAAGTAGAACCACCTTGG - Intronic
1196726944 X:118904058-118904080 CTGAAGCAGGAGAATCACTTGGG + Intergenic
1198426052 X:136521277-136521299 CTGCAGCAGCAGCACCACCTGGG - Intergenic
1198735017 X:139775827-139775849 CTACAGCAGCACAAACACAGTGG - Intronic
1199007100 X:142713263-142713285 CTGAAGCTGCTGAAGCACAAAGG - Intergenic
1199458107 X:148052422-148052444 ATGAAGCTGCAGAACCAATGAGG + Intergenic
1199770625 X:150973120-150973142 GTGAAGCTGCTGTACCACAGTGG + Intergenic