ID: 1181571057

View in Genome Browser
Species Human (GRCh38)
Location 22:23767992-23768014
Sequence CTCAGGAACACGCCCCCAGC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 116}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181571045_1181571057 10 Left 1181571045 22:23767959-23767981 CCGGCGCAAAAAAGGCGGGGCCC 0: 1
1: 0
2: 0
3: 6
4: 47
Right 1181571057 22:23767992-23768014 CTCAGGAACACGCCCCCAGCGGG 0: 1
1: 0
2: 0
3: 14
4: 116
1181571040_1181571057 28 Left 1181571040 22:23767941-23767963 CCGCAGCGCTTGTCACAGCCGGC 0: 1
1: 0
2: 0
3: 2
4: 90
Right 1181571057 22:23767992-23768014 CTCAGGAACACGCCCCCAGCGGG 0: 1
1: 0
2: 0
3: 14
4: 116
1181571052_1181571057 -10 Left 1181571052 22:23767979-23768001 CCCCGGGCGGGGCCTCAGGAACA 0: 1
1: 0
2: 0
3: 12
4: 128
Right 1181571057 22:23767992-23768014 CTCAGGAACACGCCCCCAGCGGG 0: 1
1: 0
2: 0
3: 14
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181571057 Original CRISPR CTCAGGAACACGCCCCCAGC GGG Exonic
900366456 1:2313792-2313814 CTCATGGAGATGCCCCCAGCTGG + Intergenic
900626025 1:3609039-3609061 TTCAGGAACACTCAGCCAGCGGG + Intronic
901122555 1:6907454-6907476 CTCAAGAACACTTCCCCAGCAGG + Intronic
902652540 1:17845964-17845986 CTCAGAAACAAGCTCTCAGCTGG + Intergenic
903179589 1:21598466-21598488 CTCAGGAACACCCCACAAGCGGG - Exonic
904478973 1:30782468-30782490 CTCAGGAACACTGCTCCATCCGG - Intergenic
904707759 1:32404329-32404351 CACAGGCACACGCCACCATCTGG + Intergenic
912270203 1:108200517-108200539 CCGAGGAAGAGGCCCCCAGCAGG + Intronic
915013467 1:152711797-152711819 CTCAGGCACACTCCCACTGCAGG - Intergenic
917733227 1:177897383-177897405 CACAGGAACAAAACCCCAGCTGG + Intergenic
922977495 1:229797837-229797859 CCCAGGAACCCGCCCTCAACAGG - Intergenic
924054557 1:240112703-240112725 CTAGAGAACACACCCCCAGCAGG - Intronic
924383643 1:243484063-243484085 CTGTGGAACACGCACCCACCAGG - Intronic
1075978643 10:126718535-126718557 CCCAGGAACTTGCCCACAGCTGG - Intergenic
1079085413 11:17441333-17441355 CTCAGGAACACACTCCCCTCTGG + Intronic
1083472191 11:62891414-62891436 CTCAGGAAGAGGCCCAGAGCAGG - Intergenic
1083629648 11:64089039-64089061 CTCAGGAACTCGTGCCCCGCCGG + Intronic
1085392888 11:76191480-76191502 CTCAGGGTCACGCACACAGCAGG - Intronic
1089112217 11:116065727-116065749 TTCAGGAACAGGCCCCGCGCCGG - Intergenic
1094818061 12:34205572-34205594 CTCAGCCACTCGCCCCCTGCCGG - Intergenic
1095048984 12:37540880-37540902 CTCAGGCACAGGCCCCCTCCTGG + Intergenic
1096491542 12:52015498-52015520 TCCAGGAACACCCTCCCAGCAGG + Exonic
1101479671 12:105084653-105084675 GTCAAGACCCCGCCCCCAGCTGG + Intergenic
1101755360 12:107617148-107617170 CTCGGAAACACCCCTCCAGCTGG + Exonic
1102986823 12:117285115-117285137 CTCAGGGACACGGGCCAAGCTGG - Intronic
1108054818 13:46475027-46475049 CTCGGGAACACACCCCAAGTGGG - Intergenic
1112933753 13:104774059-104774081 CACAGAAACACGCACTCAGCTGG - Intergenic
1115147171 14:30239156-30239178 ATCAGGAACACAACCCCAGAAGG + Intergenic
1118774571 14:68965667-68965689 CTCAGGACCACACCCTAAGCAGG + Intronic
1122595191 14:102885503-102885525 CTCATGGACAGGCACCCAGCAGG + Intronic
1122936028 14:104956672-104956694 TGCAGGAAGACGCCCCCGGCAGG - Exonic
1122996373 14:105267442-105267464 CACAGGTACACACCACCAGCTGG + Intronic
1128155532 15:65389441-65389463 CTCAGGCACACTCTCCCAGCAGG + Intronic
1131262200 15:90893284-90893306 GTCAGGAAGTCGCCCCCTGCAGG - Exonic
1132617965 16:851742-851764 CTCAGGGAGACCCCCTCAGCTGG - Intergenic
1132855365 16:2042511-2042533 CTCCGGCACAGGCCCCCTGCAGG + Intronic
1132934037 16:2472111-2472133 CTCAGGACCATGGCCGCAGCTGG + Exonic
1133292990 16:4734881-4734903 CTCAGAGCCCCGCCCCCAGCCGG - Intronic
1136913842 16:34163379-34163401 CACGGGAACTCGGCCCCAGCCGG - Intergenic
1137576170 16:49601772-49601794 CTCAGGAACACAGCCGCAGCTGG + Intronic
1145954141 17:28842864-28842886 CTGAGGAAGACGCCCCCGGCAGG - Intronic
1148830260 17:50426385-50426407 CTCAGGTACTGGCCCCCCGCGGG + Exonic
1149993876 17:61397039-61397061 CTCAGGACCGCGGCCCCACCCGG + Intergenic
1151443486 17:74148578-74148600 CTCAGGAACAGGTTCCCTGCAGG - Intergenic
1152529115 17:80906594-80906616 CCCAGGGACACGTCCCCTGCGGG - Intronic
1152783392 17:82236282-82236304 CCCAGCTACACGCGCCCAGCAGG - Intronic
1153825627 18:8871582-8871604 CTCAGGCCCATGGCCCCAGCTGG + Intergenic
1156471063 18:37377530-37377552 CTCAGGAACGACCCCTCAGCTGG - Intronic
1159743786 18:72207455-72207477 CTCAGGATCACACCGCCTGCAGG + Intergenic
1160728731 19:630674-630696 CTCAGCAAGACCCCCCCAGCTGG + Intronic
1162049258 19:8022539-8022561 CTCTGGAAAACGTCCCGAGCTGG - Intronic
1164305990 19:24004088-24004110 CACAGGAACTCGGCCCCAGCCGG + Intergenic
1164915328 19:32047363-32047385 CTGAAGAACACTGCCCCAGCGGG + Intergenic
1166941988 19:46372899-46372921 CTCAGGAGCAGGAGCCCAGCAGG + Intronic
926593773 2:14767714-14767736 CTCAGGGACAGGGACCCAGCTGG - Intergenic
927520201 2:23693804-23693826 CCCAGGAACACGGACCCAGCTGG + Intronic
927713745 2:25340715-25340737 CTCACGCACACGCACCCCGCCGG - Intronic
928112610 2:28522728-28522750 CTCAGGAACACGACTCCATCAGG + Intronic
930442047 2:51421039-51421061 CACAGGCACATGCCACCAGCAGG - Intergenic
934976411 2:98805860-98805882 CTCAGAAACCCGCCTCCCGCTGG + Intronic
937872968 2:126798935-126798957 CTCAGGAACATGCCCCTCCCGGG - Intergenic
938448414 2:131394769-131394791 GTCAGCTACCCGCCCCCAGCTGG - Intergenic
943494617 2:188606011-188606033 CTATGGAAGACGACCCCAGCAGG + Intergenic
944595187 2:201254764-201254786 CTCAGGACCAGGCCTCCAGGTGG + Intronic
945251247 2:207768171-207768193 CACACGAACGGGCCCCCAGCGGG + Exonic
946225657 2:218262869-218262891 CTCAGGAAGAAGCAGCCAGCAGG - Exonic
946230256 2:218286885-218286907 CTCAGGAAACCCCACCCAGCAGG + Intronic
946466762 2:219918992-219919014 CTTAGGATCACCCCCCCAGCAGG - Intergenic
948699923 2:239753048-239753070 CTCGGGAACACGCACCAAGGAGG + Intergenic
948942099 2:241201729-241201751 CTCAGGAACAGGCCTCCTGCCGG - Intronic
1169751705 20:9001256-9001278 TTCAGGAACAGGCCCCCATGGGG - Intergenic
1171230479 20:23480315-23480337 CTCAGGAACAGGCTCACAGAGGG + Intergenic
1171543525 20:25984382-25984404 CTCAGGCACAGGCCCCCTCCTGG + Intergenic
1171810224 20:29741221-29741243 CACGGGAACTCGGCCCCAGCCGG + Intergenic
1171908749 20:30921952-30921974 CACGGGAACTCGGCCCCAGCCGG - Intergenic
1174183535 20:48689848-48689870 CTCAGGAATATGGGCCCAGCGGG - Intronic
1175404358 20:58717064-58717086 CTCAGGACCAGGGACCCAGCTGG + Intronic
1175904386 20:62372354-62372376 CACAGGACCACGGCTCCAGCAGG + Intergenic
1178473532 21:32916879-32916901 CTGAGGGACACTCCCCCTGCTGG + Intergenic
1179979705 21:44889596-44889618 CTCAGGAACATCCCCCAGGCTGG - Intronic
1180946430 22:19696232-19696254 CCCAGGAACACTTCCCCAGTGGG + Intergenic
1181571057 22:23767992-23768014 CTCAGGAACACGCCCCCAGCGGG + Exonic
1182067341 22:27439895-27439917 CTCTGGGATACGCCCCCATCAGG + Intergenic
1182308191 22:29386071-29386093 CTCAGACACAGGCCCCCAGCAGG + Intronic
1184641774 22:45876777-45876799 CTCAGGAACCCGCTCCTAGCTGG + Intergenic
1185337093 22:50275581-50275603 CCCTGGAACGCGCCCCAAGCCGG - Exonic
954133431 3:48571199-48571221 CTCACGACCAGGACCCCAGCAGG + Intronic
954301635 3:49703566-49703588 CTCAGGGACAGTCCCCCACCTGG - Intronic
961418032 3:126775843-126775865 CTGAGGAACATGACCCCAGCAGG - Intronic
965133012 3:164725590-164725612 CACATGAACACGCACCCACCGGG + Intergenic
968664856 4:1815396-1815418 CCCTGGACCCCGCCCCCAGCTGG - Intronic
969478706 4:7435419-7435441 CTCAGGGCCACGTGCCCAGCTGG + Intronic
979873374 4:125855013-125855035 CTCAGGCACAGACCCACAGCAGG - Intergenic
980809223 4:137853664-137853686 CTGAGGAACCCGCGCCCATCCGG - Intergenic
981073529 4:140569047-140569069 CTCCCGGACACGCCCCCGGCAGG - Intergenic
985851114 5:2389655-2389677 CCCAGGCACATGCCCACAGCAGG + Intergenic
990327627 5:54694028-54694050 GGCAGGAAGAAGCCCCCAGCAGG + Intergenic
998158513 5:139799753-139799775 CCCAGCAACACCCTCCCAGCAGG - Intronic
998920823 5:147065861-147065883 CTCACGGACCCGCACCCAGCAGG - Intronic
1003444686 6:6173805-6173827 CTCAGAAACAGGCCCTCTGCTGG - Intronic
1007715810 6:43855483-43855505 CTCAGGATCTAGCCCCTAGCAGG - Intergenic
1010606322 6:77892956-77892978 CTTAGGAACTCTCCCACAGCTGG + Intronic
1012633674 6:101507789-101507811 ATCAGGATCATGCCCCCAGAAGG + Intronic
1013538719 6:111087435-111087457 CTCCCGGCCACGCCCCCAGCCGG + Intergenic
1013797279 6:113901734-113901756 CTCAGGCACACCCCCACAGAAGG + Intergenic
1017709006 6:157148960-157148982 CCCAGGAGCACGCCCCGGGCAGG + Intronic
1018700790 6:166424425-166424447 CTCAGGACTACGCACACAGCTGG + Intronic
1022785890 7:33636175-33636197 CTCAGAAACCCGCCCTCGGCTGG - Intergenic
1025294899 7:57769461-57769483 CTCAGGCACAGGCCCCCTCCTGG + Intergenic
1029423387 7:100483344-100483366 CGCCGGAGCACGCCCCCTGCTGG + Intergenic
1031613125 7:123850380-123850402 CACAGGAACGCACCACCAGCCGG + Intronic
1033230903 7:139596716-139596738 AACAGAAACACGCCCCCACCAGG - Exonic
1038524798 8:28263590-28263612 CACAGGAACACACCTGCAGCTGG + Intergenic
1041088522 8:54280192-54280214 CTCAGGACCAAGCCCAAAGCAGG - Intergenic
1042830317 8:73019668-73019690 TACAGGCACACGCCCCCACCTGG + Intronic
1043861456 8:85321931-85321953 CCCAGGAAAAGGACCCCAGCTGG - Intergenic
1044289329 8:90448949-90448971 ATCAGGAAGACCCCCCCACCAGG - Intergenic
1045028968 8:98117205-98117227 CGCACGAGCCCGCCCCCAGCGGG - Exonic
1047443293 8:124898243-124898265 CTCAGGAAAACTTCCTCAGCTGG + Intergenic
1048164103 8:132046860-132046882 TTCAGGAAGATGCCCCCAGGTGG + Intronic
1049244204 8:141552953-141552975 CTCAGCAACAGCCGCCCAGCTGG + Intergenic
1049409612 8:142466612-142466634 CTGAGGACCAAGCCCCCACCAGG + Intronic
1060229772 9:121818125-121818147 CTCACCAACACCCCTCCAGCCGG - Intergenic
1061008644 9:127942599-127942621 CCCAGGAAGAGGCCGCCAGCAGG + Exonic
1062482175 9:136757618-136757640 CTCAGCAACCCGCCCAGAGCCGG + Intronic
1203360513 Un_KI270442v1:216960-216982 CACGGGAACTCGGCCCCAGCCGG + Intergenic
1189266489 X:39720591-39720613 CTCAGGCACACACCTTCAGCAGG + Intergenic
1189676646 X:43467764-43467786 CACAGGAACAAGCCCCATGCAGG + Intergenic
1190490581 X:50979046-50979068 CCCAGGGACACGCTCCCATCTGG - Intergenic
1193995613 X:88363660-88363682 TCCTGGAACACTCCCCCAGCAGG + Intergenic
1201077924 Y:10200580-10200602 CACAGGAACTCGACCCCAGTGGG - Intergenic