ID: 1181571230

View in Genome Browser
Species Human (GRCh38)
Location 22:23768590-23768612
Sequence GCCGGCCCGGGGAATCCGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 62
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 58}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181571230_1181571239 2 Left 1181571230 22:23768590-23768612 CCCACCGGATTCCCCGGGCCGGC 0: 1
1: 0
2: 0
3: 3
4: 58
Right 1181571239 22:23768615-23768637 GACCGCCCCCACCTAGTCCCTGG 0: 1
1: 0
2: 0
3: 5
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181571230 Original CRISPR GCCGGCCCGGGGAATCCGGT GGG (reversed) Intronic
903233757 1:21936996-21937018 GCCGGCCCGGGGTCCCCGGCGGG + Intronic
917967835 1:180189545-180189567 GCCGGCCAGGGAAATACTGTGGG - Exonic
919458677 1:197850241-197850263 AGGGGCCGGGGGAATCCGGTAGG - Intergenic
920576944 1:207068444-207068466 GCCAGCCCGGGGGATCAGGGAGG + Intronic
1064156938 10:12909992-12910014 GCCCTCCCGGGGAATGCGATGGG + Intronic
1076373787 10:129970669-129970691 GCCGGGCCGGGGAGTCCGTCCGG + Intergenic
1076849180 10:133084678-133084700 GTCGGCCCTGGGCATCCGCTTGG + Intronic
1086349924 11:85935063-85935085 GCCGTCCCTGGGAATCCCGCAGG - Intergenic
1090920662 11:131203588-131203610 CCCAGCCCGGGGAATCAGGCAGG - Intergenic
1091558493 12:1593850-1593872 GCAGGCCCGGGGCATCCGCCGGG - Exonic
1091837842 12:3598252-3598274 ACCGGCCAGGGGAATGGGGTGGG + Intergenic
1093330019 12:17824763-17824785 GCTGGCCAGGGCAATCAGGTAGG + Intergenic
1095116114 12:38354181-38354203 TCTGGCCAGGGGAATCAGGTAGG - Intergenic
1097990263 12:65825598-65825620 GGCGGCCCGGGGAAGGCGGGAGG + Intronic
1103557425 12:121775013-121775035 GCCGGCCAGGGGAGTCTGGTGGG + Intronic
1106087713 13:26558009-26558031 GCCGGCCGGGAGAATGCGGCCGG - Intronic
1114092564 14:19302549-19302571 GCCGGCCCGGGACATCCAGGTGG + Intergenic
1117156820 14:52950635-52950657 GCCGGCGCTGCGAATTCGGTGGG - Intronic
1119522157 14:75294335-75294357 GCCGGCCCGGGGTAGGCTGTGGG + Intergenic
1122598891 14:102911554-102911576 GACAGCCCGGGGAGTCCGGCAGG - Intergenic
1124595464 15:31088304-31088326 GCCAGCCCTGGCAATCCGCTCGG + Intronic
1129150331 15:73684350-73684372 GGCGGCCCGGGGAGTCCGAGGGG - Exonic
1129299304 15:74616166-74616188 GCCTGCCCGCGGAATGGGGTCGG + Intronic
1132845348 16:1998674-1998696 GCGGGCCCGGGGAGTCCAGATGG - Intronic
1141050755 16:80761212-80761234 GCCCGCCAGGGGATTCTGGTGGG + Intronic
1147786293 17:42980789-42980811 TCCGGCCCGGCGAATCCGGCGGG - Exonic
1148003064 17:44401656-44401678 GCTGGCCCTGGGAATTTGGTAGG - Intronic
1152362605 17:79839559-79839581 CCAGGCCCGGGGCCTCCGGTAGG - Intergenic
1155392108 18:25349631-25349653 GCCGGCCCGGGGAAAAGGGGTGG - Intronic
1160445657 18:78925193-78925215 GTCGGCCCAGGAAATCCGGGAGG + Intergenic
1160991522 19:1862269-1862291 GCCGCCCCGGGGACTGCGCTAGG + Intronic
1163687343 19:18719324-18719346 GCAGGCCCTGGGGACCCGGTGGG - Intronic
1166043817 19:40218023-40218045 GCCGGCCCGGGGCTGCTGGTGGG + Exonic
1168706938 19:58475769-58475791 GCTGGCCCGGGGAATGGCGTGGG + Intronic
929588370 2:43130198-43130220 GGCAGCCAGGGGAAGCCGGTGGG - Intergenic
931242004 2:60461906-60461928 GCCGGCCTGGGGACAGCGGTGGG + Exonic
934112441 2:88756305-88756327 GCCTTCCCGGGGAATCCTGAGGG - Intergenic
948309272 2:236972825-236972847 CCCGGCTCGGGGAATTCTGTGGG - Intergenic
1175748326 20:61477153-61477175 GCCTGCCAGCGGAATCCTGTGGG + Intronic
1180488165 22:15820017-15820039 GCCGGCCCGGGACATCCAGGTGG - Intergenic
1181062827 22:20290173-20290195 GCCGGCCCAGGGAACCAGGCAGG + Intergenic
1181571230 22:23768590-23768612 GCCGGCCCGGGGAATCCGGTGGG - Intronic
1182116930 22:27761941-27761963 GCAGGACCGGGGAATGCGGGGGG + Intronic
1183601768 22:38844098-38844120 GCCGGCCCGGGGAAGCGAGTGGG - Intergenic
1184390600 22:44201127-44201149 GCCCGCCCAGGGAAGCAGGTGGG - Intronic
1184458411 22:44624229-44624251 GCCTGCCCGGGGAACCCCGAAGG - Intergenic
954912690 3:54122387-54122409 GCGGCCCCGGGGAGTCCGGCGGG - Intergenic
963160866 3:142149584-142149606 GCCGGCCCGGCCAATCCGTGGGG - Intergenic
967951037 3:194840822-194840844 GCCGGCATCGGGAATCCAGTCGG + Intergenic
978490094 4:109302885-109302907 GCCGGCCCGGGGAACCCCCAAGG + Intergenic
978776219 4:112509539-112509561 GCCTGCCCGGGTAATCAGGGAGG + Intergenic
985822605 5:2170276-2170298 GGCGGCTTGGGGAATGCGGTTGG + Intergenic
986284192 5:6347861-6347883 GGGGGCCCAGGGAATGCGGTGGG + Intergenic
992591102 5:78295904-78295926 GCCGCCCCAGGGAAGGCGGTGGG + Intergenic
998322044 5:141241634-141241656 GCCCGCCCGGGGCATCAGCTCGG - Intergenic
1003133967 6:3418744-3418766 GCTGGGCCTGGGAATCCAGTTGG - Intronic
1019310296 7:357189-357211 GGCAGCCCTGGGAAGCCGGTGGG + Intergenic
1033283567 7:140022414-140022436 GGCGGCCAGAGGGATCCGGTGGG - Intergenic
1037647304 8:20804140-20804162 GCTGGGCAGGGGAATCTGGTGGG + Intergenic
1042954623 8:74236570-74236592 GACTGCCCGAGGAATGCGGTCGG - Exonic
1061451371 9:130668668-130668690 GGCGGCCCAGGGAATGCGTTGGG + Intronic
1200930620 Y:8693765-8693787 GCAGGCCTGGGGAATCCTGAAGG + Intergenic