ID: 1181571231

View in Genome Browser
Species Human (GRCh38)
Location 22:23768591-23768613
Sequence GGCCGGCCCGGGGAATCCGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 130}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181571231_1181571239 1 Left 1181571231 22:23768591-23768613 CCACCGGATTCCCCGGGCCGGCC 0: 1
1: 0
2: 1
3: 21
4: 130
Right 1181571239 22:23768615-23768637 GACCGCCCCCACCTAGTCCCTGG 0: 1
1: 0
2: 0
3: 5
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181571231 Original CRISPR GGCCGGCCCGGGGAATCCGG TGG (reversed) Intronic
900091734 1:923821-923843 GGCCGACTCGGGGCATCCGGCGG - Intergenic
900226363 1:1535211-1535233 GGCCGGCCGGGAGAGTCCAGTGG - Exonic
900522181 1:3111117-3111139 GGCCTGCCCTGGGAATCCCTGGG - Intronic
900596920 1:3484116-3484138 GGCTGGCCCTGGGACCCCGGCGG + Intergenic
901421102 1:9151774-9151796 GGCCGGTCCACGGCATCCGGAGG + Intergenic
903233756 1:21936995-21937017 CGCCGGCCCGGGGTCCCCGGCGG + Intronic
903855741 1:26336792-26336814 GGCGGGCCCGGGCGAGCCGGGGG - Intronic
903862012 1:26370340-26370362 GGCCAGTCAGGGGCATCCGGGGG - Intronic
904738202 1:32651276-32651298 GGCGAGCCGGGGGAATCCTGGGG - Exonic
905734350 1:40315618-40315640 GGCGGTCCCGGGGGACCCGGGGG + Exonic
908934850 1:69362804-69362826 GGACGCCCCAGGGAATCCTGTGG - Intergenic
917967836 1:180189546-180189568 GGCCGGCCAGGGAAATACTGTGG - Exonic
923463865 1:234231428-234231450 GCCGGGCCCGGGGAGTCCCGGGG - Exonic
1066093988 10:32055800-32055822 GGCCGGCCCGAAGAAGCGGGAGG + Intronic
1067703617 10:48590761-48590783 GGCCGTCCTGGGGACTCTGGAGG + Intronic
1077194595 11:1272774-1272796 GGCCGGGCCCAGGGATCCGGGGG + Intergenic
1077404729 11:2377853-2377875 GGCCGGGCCGGGGCTTCTGGGGG + Intronic
1079428258 11:20363955-20363977 GGCCGGGCCGGGGATACCGTGGG + Intronic
1081465435 11:43312259-43312281 GCTCGGCCCGGGGAGTGCGGCGG - Intronic
1083643156 11:64156484-64156506 GGCAGGCCCTGGGAATCCCATGG + Intronic
1083808081 11:65087002-65087024 GGCCGGCCTGGGGAAGCTGGGGG - Exonic
1084182948 11:67455674-67455696 GGCCGGCCCAGGGGATGCAGGGG - Exonic
1088913799 11:114211869-114211891 GGCCGGCCCCTGGAATGCTGAGG + Intronic
1089524029 11:119084967-119084989 CCCCGGCCCCGGGAAGCCGGGGG - Exonic
1091145083 11:133272578-133272600 GGCCGGCCCGGGGACGCTCGGGG + Intronic
1091558494 12:1593851-1593873 TGCAGGCCCGGGGCATCCGCCGG - Exonic
1091696944 12:2633995-2634017 GGCCGCCCCGGGGAGCCGGGCGG - Intronic
1091837841 12:3598251-3598273 GACCGGCCAGGGGAATGGGGTGG + Intergenic
1103557424 12:121775012-121775034 GGCCGGCCAGGGGAGTCTGGTGG + Intronic
1103562663 12:121800468-121800490 GGCCGGTCCGCGGCTTCCGGAGG + Intronic
1113992085 14:16035673-16035695 GGCCCACCCGGGGCATCTGGTGG - Intergenic
1114491662 14:23106197-23106219 GGCAGGCCGGGGGAGGCCGGGGG - Intergenic
1116817921 14:49599938-49599960 GGCCGGGGCGGGGGCTCCGGGGG + Intronic
1117156821 14:52950636-52950658 GGCCGGCGCTGCGAATTCGGTGG - Intronic
1117842106 14:59870606-59870628 GGCCGCGCCGGGGGATCCGCAGG - Exonic
1119622097 14:76138897-76138919 GGCCGGCCCGAACAATGCGGCGG + Intergenic
1122697288 14:103562357-103562379 GCCCGGCCGGGGGAAGCCGGGGG + Intronic
1129150332 15:73684351-73684373 GGGCGGCCCGGGGAGTCCGAGGG - Exonic
1129791198 15:78341618-78341640 GGCGGGCGCGGGGGATACGGCGG - Intronic
1134466931 16:14487063-14487085 GGCCCACCCGGGGCATCCGGTGG + Intronic
1136386016 16:29926325-29926347 GACCCGCCCGGGGAACCCGCAGG - Exonic
1136419509 16:30123131-30123153 GGTCGGCCCGGGGGTCCCGGGGG - Exonic
1136513509 16:30753793-30753815 GCCAGGCCAGGGGAACCCGGAGG + Intronic
1136911459 16:34147639-34147661 GGCCCACCCGGGGCATCTGGTGG - Intergenic
1138387269 16:56644187-56644209 GGCCTTCCCTGGGAATCTGGGGG + Intronic
1138497161 16:57415697-57415719 GGCCGTCCCAGGGACTCTGGGGG + Intronic
1140528860 16:75647395-75647417 GGCGTGCCCGGGGTATCCCGGGG + Intronic
1141154564 16:81588148-81588170 GCCCAGCCCTGGGGATCCGGAGG - Intronic
1142156273 16:88534117-88534139 GGCCGGCCCAGGGGGTCCCGGGG - Exonic
1142240080 16:88941024-88941046 GGGGGGTCCGGGGGATCCGGCGG + Intronic
1142350420 16:89576897-89576919 GGCGGGCACGGGGCCTCCGGGGG - Intronic
1147786294 17:42980790-42980812 GTCCGGCCCGGCGAATCCGGCGG - Exonic
1149772373 17:59331910-59331932 GCCCGGCCGGGGGAGTCCGGAGG - Intronic
1150488779 17:65560916-65560938 GGCCGGCCCGGGGGGGCCCGGGG - Intronic
1151947061 17:77325553-77325575 GGCCAGCCCGGGGCGTCCTGAGG + Intronic
1152103124 17:78314301-78314323 GGGCAGCCCGGGGAAGCCGTGGG + Intergenic
1152362353 17:79838718-79838740 GGCCGAGCCGGGGAGGCCGGCGG - Intronic
1152648565 17:81481588-81481610 GGCCGGCCCGGGGGAGGGGGCGG + Intergenic
1155062691 18:22242619-22242641 GGCCGAACCTGGGAATCTGGGGG + Intergenic
1157292573 18:46420388-46420410 GCCCGGCCCTGTGAATACGGTGG - Intronic
1160499598 18:79395518-79395540 GGCGGGAACGGGGAATCCGGGGG - Intergenic
1160540217 18:79617124-79617146 GGCCTCTCCGGGGGATCCGGGGG - Intergenic
1160768774 19:821345-821367 GGCAGGACCGGGGTGTCCGGCGG - Intronic
1161156129 19:2732697-2732719 GTCCGGCCCGGGGCTCCCGGCGG + Exonic
1161221962 19:3122017-3122039 GGGCTGCCCGGGGACTCCAGAGG + Exonic
1162929882 19:13952564-13952586 GGCGGCCCCGGGGGAGCCGGAGG + Exonic
1163266600 19:16226024-16226046 GGCCGGCCCGGAGCATTCAGGGG + Intronic
1166306848 19:41940234-41940256 GGCGGGCGCGGGGAGCCCGGGGG + Intergenic
1166596153 19:44051966-44051988 GGCGGGTCCGGGGAATTCTGGGG + Intronic
1168706937 19:58475768-58475790 GGCTGGCCCGGGGAATGGCGTGG + Intronic
927515303 2:23668728-23668750 GGCTGGCCTGGGGGATCAGGAGG - Intronic
927653068 2:24923945-24923967 GGCCCCCCCGGGGAATGTGGTGG + Intergenic
927997215 2:27494825-27494847 GGGCCGCCCGGGCAATGCGGGGG - Intronic
929966914 2:46542994-46543016 GGCCGGGGCGGGGGCTCCGGGGG + Exonic
929983121 2:46699252-46699274 GGCCTGGCGGGGGCATCCGGCGG + Intronic
931242003 2:60461905-60461927 GGCCGGCCTGGGGACAGCGGTGG + Exonic
934112442 2:88756306-88756328 AGCCTTCCCGGGGAATCCTGAGG - Intergenic
934989745 2:98912836-98912858 GGCCTGACGGTGGAATCCGGGGG + Intronic
936556811 2:113503578-113503600 CGCGGTCCCGGGGAGTCCGGCGG - Intergenic
938455671 2:131460946-131460968 GGCCGGGGCGGGGGCTCCGGGGG + Intergenic
942460565 2:176165423-176165445 GGCGGGCCCGGGGAAGCGGGCGG + Intronic
944690662 2:202155744-202155766 GGGCAGCCCAGGGAATTCGGAGG - Intronic
948309274 2:236972826-236972848 GCCCGGCTCGGGGAATTCTGTGG - Intergenic
1171868575 20:30508496-30508518 GGCCCACCCGGGGCATCTGGTGG + Intergenic
1171906786 20:30905916-30905938 GGCCCACCCGGGGCATCTGGTGG - Intergenic
1172979031 20:38927097-38927119 GAGCGGCCCGGGGGATCCGGGGG - Intronic
1173952913 20:47007406-47007428 GGCAGGCCCTGGGAATGGGGAGG + Intronic
1176551431 21:8224118-8224140 GGCCCACCCGGGGCATCCGGTGG - Intergenic
1176570340 21:8407117-8407139 GGCCCACCCGGGGCATCCGGTGG - Intergenic
1176578249 21:8451304-8451326 GGCCCACCCGGGGCATCCGGTGG - Intergenic
1179916373 21:44480757-44480779 GGCCGGCCCTGGGCAGCCAGGGG - Intergenic
1180315186 22:11271854-11271876 GGCCCACCCGGGGCATCTGGTGG + Intergenic
1180340203 22:11611990-11612012 GGCCCACCCGGGGAATCTAGTGG - Intergenic
1180581957 22:16846121-16846143 GGCCAGCCCGGGGACTGCTGTGG + Intergenic
1181571231 22:23768591-23768613 GGCCGGCCCGGGGAATCCGGTGG - Intronic
1182116929 22:27761940-27761962 GGCAGGACCGGGGAATGCGGGGG + Intronic
1183601769 22:38844099-38844121 GGCCGGCCCGGGGAAGCGAGTGG - Intergenic
1184358324 22:43997209-43997231 GATCTGCCCGGGGAATCCAGGGG + Intronic
1203256453 22_KI270733v1_random:141062-141084 GGCCCACCCGGGGCATCCGGTGG - Intergenic
954912691 3:54122388-54122410 GGCGGCCCCGGGGAGTCCGGCGG - Intergenic
961780028 3:129315924-129315946 GGGCGGCGCGCGGAAGCCGGGGG + Exonic
963160867 3:142149585-142149607 TGCCGGCCCGGCCAATCCGTGGG - Intergenic
969604916 4:8197642-8197664 GGCCGGGCCGGGGAGCCTGGAGG + Intronic
980930347 4:139177692-139177714 GGCCGGCGGGGGAAAGCCGGCGG - Intergenic
984698958 4:182806467-182806489 GGCCCGCCCGGGGATGCAGGAGG - Intergenic
985071437 4:186170187-186170209 TGCCGGCCTGTGCAATCCGGAGG + Intronic
985535867 5:465460-465482 GGGCGGCCTCGGGAAGCCGGCGG - Intronic
986284191 5:6347860-6347882 GGGGGGCCCAGGGAATGCGGTGG + Intergenic
987124448 5:14798409-14798431 GGCGAGCCGGGGGAATCCTGGGG + Intronic
992591101 5:78295903-78295925 GGCCGCCCCAGGGAAGGCGGTGG + Intergenic
1001226163 5:169946279-169946301 GCCCAGCCAGGGGTATCCGGAGG + Intronic
1002439602 5:179257454-179257476 GCCCAGCCCGGGGAGTCCAGGGG + Intronic
1003603769 6:7541843-7541865 GGCCGGCGCGGAGAAAGCGGAGG - Exonic
1006110322 6:31740528-31740550 GGCCGGGCTGGGGAAGCCGGAGG - Exonic
1006302075 6:33199181-33199203 GACAGGCCCGGAGAATCCTGGGG + Exonic
1010703166 6:79077290-79077312 GGCCGGCGCGGGGTCTGCGGGGG - Intronic
1011640379 6:89412008-89412030 GGCCGGCCCGGGGACGGCGGGGG + Exonic
1018945701 6:168345827-168345849 GGACAGCCGGGGGAAGCCGGGGG + Intergenic
1018945711 6:168345848-168345870 GGACAGCCGGGGGAAGCCGGGGG + Intergenic
1018945722 6:168345869-168345891 GGGCAGCCGGGGGAAGCCGGGGG + Intergenic
1018945732 6:168345890-168345912 GGACAGCCGGGGGAAGCCGGGGG + Intergenic
1018945756 6:168345943-168345965 GGACAGCCGGGGGAAGCCGGGGG + Intergenic
1018945767 6:168345964-168345986 GGGCAGCCGGGGGAAGCCGGGGG + Intergenic
1018945791 6:168346015-168346037 GGGCAGCCGGGGGAAGCCGGGGG + Intergenic
1019373106 7:673870-673892 GGCCTGCCCGGGGCCTCTGGAGG - Intronic
1019897654 7:3995184-3995206 GGTGTGCCCAGGGAATCCGGAGG - Intronic
1023508366 7:40923644-40923666 TGCAGGCCTGGGGAATCTGGTGG - Intergenic
1024471992 7:49774673-49774695 GGCCGGGTCGGGGATTCCCGGGG - Intronic
1026916104 7:74121175-74121197 GGCCGGCCAGGTGCATGCGGAGG - Exonic
1029528737 7:101111458-101111480 GACTGGCCTGGGGAATCCCGGGG + Intergenic
1029640317 7:101816155-101816177 GGCCAGCCCGGGGCCCCCGGCGG - Intronic
1030173541 7:106628383-106628405 GGCTGGCCCTGGGGATCCTGGGG - Intergenic
1032122814 7:129169156-129169178 GGCCGGGACGGGGAATGAGGAGG + Intronic
1032239426 7:130149508-130149530 GGCCGCCCCGGGGGAGCAGGAGG - Intergenic
1033283568 7:140022415-140022437 GGGCGGCCAGAGGGATCCGGTGG - Intergenic
1034254031 7:149714803-149714825 GGCCGGGCCGCCGAAGCCGGGGG + Intronic
1034338567 7:150338556-150338578 GGCCAGCCCTGGGAATGCTGAGG - Intronic
1036185943 8:6622402-6622424 GGACGGCCTGGGGAATGCGGAGG + Intronic
1037647303 8:20804139-20804161 GGCTGGGCAGGGGAATCTGGTGG + Intergenic
1047235951 8:123042155-123042177 GGTCGGCACGGGGAGTCGGGCGG - Exonic
1049406026 8:142452213-142452235 GGCTGGCCCGGGAGACCCGGCGG + Intronic
1049751188 8:144285008-144285030 GACCGGCCCGGGGCGTCCTGCGG - Intronic
1054464162 9:65483069-65483091 GGGCGGCACGGGGAAGCCGCAGG + Intergenic
1060700440 9:125746438-125746460 GGCCGGCCCGGTCTATCCCGGGG + Intergenic
1061089945 9:128420829-128420851 GGCCGGCCCGAGAGCTCCGGGGG + Exonic
1061207965 9:129175286-129175308 GGCCGCCCCGGGGTCTCCAGCGG - Intergenic
1203472610 Un_GL000220v1:122762-122784 GGCCCACCCGGGGCATCCGGTGG - Intergenic
1203363471 Un_KI270442v1:237763-237785 GGCCCACCCGGGGCATCTGGTGG + Intergenic
1185471448 X:386452-386474 GCCCGGCCCGGGGGTTCCCGGGG + Exonic
1190320321 X:49176151-49176173 GGCTGGCCGGGGGACTCTGGGGG + Exonic
1200926875 Y:8662563-8662585 GGCTGGCCTGAGGAATCCTGCGG - Intergenic
1200931180 Y:8698497-8698519 GGCAGGCCTGAGGAATCCTGAGG + Intergenic
1201074838 Y:10179075-10179097 GGCCCACCCGGGGCATCTGGTGG - Intergenic