ID: 1181571364

View in Genome Browser
Species Human (GRCh38)
Location 22:23769353-23769375
Sequence CCCCTCCATAAGGAAGGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 182}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181571356_1181571364 17 Left 1181571356 22:23769313-23769335 CCCAGAAGTGGGGGTGTGGGTCA 0: 1
1: 0
2: 1
3: 26
4: 287
Right 1181571364 22:23769353-23769375 CCCCTCCATAAGGAAGGAGCAGG 0: 1
1: 0
2: 1
3: 12
4: 182
1181571357_1181571364 16 Left 1181571357 22:23769314-23769336 CCAGAAGTGGGGGTGTGGGTCAC 0: 1
1: 0
2: 1
3: 19
4: 209
Right 1181571364 22:23769353-23769375 CCCCTCCATAAGGAAGGAGCAGG 0: 1
1: 0
2: 1
3: 12
4: 182
1181571360_1181571364 -6 Left 1181571360 22:23769336-23769358 CCAAGTAAGAGAGGAGGCCCCTC 0: 1
1: 0
2: 2
3: 10
4: 129
Right 1181571364 22:23769353-23769375 CCCCTCCATAAGGAAGGAGCAGG 0: 1
1: 0
2: 1
3: 12
4: 182

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181571364 Original CRISPR CCCCTCCATAAGGAAGGAGC AGG Intronic
900567153 1:3339149-3339171 GCCCTCCAGAAGGAGAGAGCAGG - Intronic
900642795 1:3695391-3695413 CCCCTCCATAGAGAGGGCGCAGG - Intronic
900990736 1:6097061-6097083 CCTCTCCATCAGGGAGCAGCGGG + Intronic
902215020 1:14929170-14929192 CCATGCCATAAGGAAGGAGGGGG + Intronic
903837816 1:26217216-26217238 CCCCTCCCAAAGAAAGGAGGTGG - Intergenic
904306831 1:29595207-29595229 CCACTCACTAAGGAAGGAACTGG - Intergenic
904329169 1:29746690-29746712 TCCCTCCCCAAGGAGGGAGCTGG + Intergenic
905251572 1:36652256-36652278 GCCTTCCCTAAGGCAGGAGCAGG + Intergenic
905340751 1:37275695-37275717 CCAGGCCATAAGGAAGGAGCAGG - Intergenic
906274531 1:44506300-44506322 TCCCACTATCAGGAAGGAGCTGG - Intronic
907323225 1:53618765-53618787 TACCTCCATCAGGAAGCAGCAGG + Intronic
910554809 1:88519590-88519612 CCCACCCACAAGGAAGAAGCAGG - Intergenic
912955514 1:114152491-114152513 CCCCTCCATGGGGGAGGGGCTGG - Intronic
918067872 1:181113589-181113611 TGCCACCAAAAGGAAGGAGCAGG - Intergenic
918881322 1:190125840-190125862 TGCCTCCATAGGGAAGAAGCAGG + Intronic
1063143127 10:3273763-3273785 CAGCTCCAGAAAGAAGGAGCAGG + Intergenic
1064011401 10:11739379-11739401 TCCCTCAATGAGGACGGAGCAGG - Intergenic
1067751849 10:48976900-48976922 GCCCTCCATCAGGCAGCAGCAGG - Exonic
1068645429 10:59461359-59461381 CCCCTTCTTTAGGAAGGAACAGG - Intergenic
1068831577 10:61501747-61501769 CCCCTCCACAAAGAATGATCTGG - Intergenic
1069299806 10:66892154-66892176 CCCCTATATAAGAAAGGAGAAGG + Intronic
1070511213 10:77162586-77162608 CCGAGCCAAAAGGAAGGAGCTGG + Intronic
1070775868 10:79109519-79109541 CACCTCCATATGGATGGTGCTGG + Intronic
1076314772 10:129532506-129532528 CCCCACCCGGAGGAAGGAGCAGG - Intronic
1078370689 11:10742217-10742239 TCCCTGCATGAGGAAGGAACTGG + Intergenic
1083134159 11:60655789-60655811 CCCCACCATTATGAAGCAGCTGG + Intergenic
1084542698 11:69797439-69797461 CCTGTCCATGAGGATGGAGCCGG - Intergenic
1085146560 11:74204391-74204413 CTCCTCCATGCAGAAGGAGCAGG - Exonic
1090064576 11:123491921-123491943 CTCCTCCCTGAGGAAGAAGCTGG + Intergenic
1091133918 11:133170801-133170823 CCTCTCCATCTAGAAGGAGCTGG + Intronic
1093013235 12:14130035-14130057 CCACTGCATGAGGAAGGCGCTGG + Intergenic
1096862752 12:54541852-54541874 CCCATCCCTGAGGAAGGAGCAGG - Intronic
1098750007 12:74280864-74280886 CCCCACCATCTGGAAGCAGCTGG + Intergenic
1100101487 12:91111659-91111681 CCATTCCATAGGGAATGAGCTGG - Exonic
1100413355 12:94345697-94345719 CTCCTGGATAAGGAAGGGGCAGG - Intronic
1104691405 12:130829099-130829121 CCCCACCATGAGGCAGGTGCTGG + Intronic
1105672790 13:22638848-22638870 ACACTCCTGAAGGAAGGAGCCGG - Intergenic
1106415053 13:29539480-29539502 CCCCTTCAAAATGAAGGGGCAGG + Intronic
1107349536 13:39499701-39499723 CACCTCCCTGAGAAAGGAGCTGG + Intronic
1110052642 13:70923826-70923848 CCCCTCCATCAAGAAGGTGCAGG + Intergenic
1112116887 13:96366055-96366077 CACCTCCCTAGGGAAGGAGTAGG - Intronic
1112117118 13:96368221-96368243 CCCATCCAAAAGTAAGGGGCTGG + Intronic
1112213863 13:97409805-97409827 TCCTTCCAGAAGGAAGGAGTAGG - Intergenic
1112314761 13:98351138-98351160 CCACTCCACAAGGAAGTACCAGG - Intronic
1112647417 13:101350309-101350331 ACCCTGCATTAGGCAGGAGCTGG - Intronic
1112708368 13:102098715-102098737 CCTCTCCAAAATGAAGGAGTAGG - Intronic
1113932723 13:113976762-113976784 CCCCTCCAAGAGGAAGTAGAAGG - Intergenic
1114265133 14:21069384-21069406 CCCCAACAGAAGGAAGGGGCTGG + Intronic
1116477600 14:45359423-45359445 CCCCAACATTAGGAAGGTGCAGG + Intergenic
1119920244 14:78439965-78439987 TCCAGCCAAAAGGAAGGAGCAGG - Intronic
1120873607 14:89359736-89359758 CTCCTCCTTAAGGAAGGAGGTGG - Intronic
1121509299 14:94500529-94500551 CCCCTCCCTAAACAAGGATCAGG - Intronic
1121676360 14:95756407-95756429 TCCCTCCATATGGAAGGAAAAGG + Intergenic
1124143436 15:27097781-27097803 TCCCTCCCTAAGGAATTAGCTGG + Intronic
1124258290 15:28163934-28163956 CACCTCCATAGGGTGGGAGCTGG - Intronic
1124513980 15:30350605-30350627 CCCTGCCATCAGGAGGGAGCAGG - Intergenic
1124728941 15:32180160-32180182 CCCTGCCATCAGGAGGGAGCAGG + Intergenic
1126116015 15:45208226-45208248 CCCCTCCTTGAAGAAAGAGCAGG - Intergenic
1126756911 15:51934080-51934102 CCCCTCCAAAATGAAGGATAAGG - Intronic
1126879648 15:53080893-53080915 CTCATCTTTAAGGAAGGAGCTGG - Intergenic
1132341228 15:101079590-101079612 CCCTCCCACAAGGAAGGAGGAGG - Intergenic
1132889362 16:2196417-2196439 CCGCGCCATGGGGAAGGAGCAGG - Exonic
1133527390 16:6618886-6618908 CCCTTAGATGAGGAAGGAGCAGG + Intronic
1133968478 16:10549058-10549080 CCTCTCCCTAAGGAGGTAGCTGG + Intronic
1136383317 16:29907129-29907151 CTGCACCAGAAGGAAGGAGCTGG - Intronic
1137039685 16:35599343-35599365 CCCTCCCCTAAGGAAGGAGAAGG - Intergenic
1138539698 16:57680409-57680431 CCCCTCCCCAGGGCAGGAGCTGG - Intronic
1139303056 16:65961816-65961838 CCCTTACATAAGGAAGGAAGGGG + Intergenic
1140070530 16:71645489-71645511 GACCTCCATAAGGGAGCAGCTGG - Exonic
1142155271 16:88530114-88530136 CCCCTCCACCAGGATGGAGAGGG + Intronic
1144087390 17:11823046-11823068 CCCCTGCAGGTGGAAGGAGCGGG - Intronic
1144101890 17:11948872-11948894 CCCCTCCAGGAGGGAGGACCTGG + Intronic
1144712600 17:17412062-17412084 CCCATCCATAAAGGAGGAGAGGG + Intergenic
1147917958 17:43900024-43900046 CCCCTCCTCCAGGAAGGAACAGG + Intronic
1148215475 17:45831843-45831865 CCCCTCCATGGGGGAGGAGAGGG - Intronic
1149535779 17:57432329-57432351 CTCCTCCATAAGGAGGCAGTGGG - Intronic
1150442572 17:65203230-65203252 CCCCTCCCTGTGGGAGGAGCTGG - Intronic
1150667648 17:67157278-67157300 CCCCTCTTTGAGGAAGAAGCAGG - Intronic
1151292563 17:73161160-73161182 CCCCTCCCCATGGAAGGGGCTGG + Intergenic
1152764859 17:82130798-82130820 CCCCCCCAAAAAAAAGGAGCTGG - Intronic
1154337334 18:13476142-13476164 CCCTTCCATAAGGAAGCCACAGG - Intronic
1156655172 18:39276381-39276403 CCTCTGCGTAAGGAAGAAGCAGG - Intergenic
1156750031 18:40441030-40441052 AACCTCCCTAGGGAAGGAGCAGG - Intergenic
1156953656 18:42935770-42935792 ACCCTCCACAGGGAGGGAGCGGG + Intronic
1157194735 18:45611459-45611481 CCTCACCAAAAGGAAGGAGAAGG + Intronic
1160329015 18:77975499-77975521 CCCCTCCATGGAGCAGGAGCAGG - Intergenic
1160865147 19:1253009-1253031 CGCCTGCGTCAGGAAGGAGCTGG + Intronic
1161487421 19:4543630-4543652 CCCCCCCATAGGGGAGGAGGTGG + Exonic
1161505282 19:4640342-4640364 CCCCTCCATAGAGAAGGTGCTGG - Intronic
1161648524 19:5469608-5469630 CCCCAGCAGAAGGAAGGAGTTGG + Intergenic
1161676829 19:5655602-5655624 CCCCTCCTTAAGGAAGGAGAGGG + Intronic
1162617463 19:11813923-11813945 CCCGTGCAGAAGGAAGGAGCAGG + Intergenic
1162621605 19:11848460-11848482 CCCGTGCAGAACGAAGGAGCGGG + Intergenic
1162626251 19:11887520-11887542 CCCATGCAGAACGAAGGAGCAGG + Intergenic
1162630665 19:11924813-11924835 CCCGTGCAGAACGAAGGAGCGGG + Intergenic
1162635537 19:11964740-11964762 CCCGTGCAGAACGAAGGAGCGGG + Intronic
1162639058 19:11993314-11993336 CCCCTCCAGAACGAAGGTGAAGG - Intergenic
1162683913 19:12365942-12365964 CCCGTCCAGGAAGAAGGAGCAGG - Intergenic
1163034348 19:14562672-14562694 CCCCTCCATAGGGCAGGGGGTGG - Intronic
1164088751 19:21928957-21928979 CCCCTCTATAAGCAAGGCCCAGG - Intergenic
1164191788 19:22924652-22924674 CCCCTCTATAAGTAAGGCCCAGG - Intergenic
1165407368 19:35639053-35639075 ACCCTCCATTAGGAGGGAGCAGG + Intergenic
1165485188 19:36091142-36091164 CCTCATCATAAGGAAGAAGCAGG + Intronic
1165647361 19:37453441-37453463 CCCCTTCAAAATGAAGGAGTGGG - Intronic
1167423495 19:49417280-49417302 CGTCTCCAGAAGGAAGGAGGTGG + Intronic
1168713595 19:58514851-58514873 CCCTTTCATAAGGAGGGACCTGG + Intronic
927074137 2:19560048-19560070 CACCTCTAGAAGGAAGCAGCAGG - Intergenic
927680698 2:25137212-25137234 CCCCTCCCCAAGGGAGGAGGGGG + Intronic
928391991 2:30917351-30917373 CCCCTCAACAAAGAAGGATCTGG + Intronic
928432160 2:31229176-31229198 CCCCTCTAGAAAGAAGGAGAAGG + Intronic
930353940 2:50293453-50293475 GCCCTGCATAGGGAAGAAGCGGG + Intronic
931652716 2:64483004-64483026 CCCCACCAGCAGGAACGAGCTGG + Intergenic
932382577 2:71298848-71298870 CCCCTCCTTAGGGAGGGAGGAGG - Intronic
935066353 2:99651950-99651972 CTCCTTCCTAAGGTAGGAGCTGG + Intronic
935382626 2:102467938-102467960 CCCCCCTATATGGAAGGAGAGGG - Intergenic
935635950 2:105250046-105250068 CCCCTTCATCTGGGAGGAGCAGG + Intergenic
938736656 2:134191913-134191935 CCCTTCCATCAGGAAGCCGCTGG - Intronic
947536823 2:230944990-230945012 GCCCTCCATGAAGCAGGAGCAGG + Intronic
948701303 2:239762127-239762149 CCCCTCCATACTCAAGGAGAGGG - Intergenic
949044019 2:241862380-241862402 ACCCTCTGTGAGGAAGGAGCAGG - Intergenic
1168881750 20:1212167-1212189 CCCTGCCAGAAGGAGGGAGCAGG - Intergenic
1169073540 20:2748663-2748685 CCCCTCCATCAGGAAAGGGTGGG - Intronic
1169626683 20:7579050-7579072 CCCCACCATCATGAAGCAGCTGG - Intergenic
1171953348 20:31440765-31440787 AACCTCCTTAAGGAAGGGGCAGG + Intronic
1174841108 20:53902169-53902191 CCCCTTCTTAAGGGAAGAGCCGG - Intergenic
1176943072 21:14947409-14947431 CCCCACCATTAGGAAGGAAATGG + Intergenic
1178110553 21:29365687-29365709 CCCCTTCCCAAGGCAGGAGCTGG + Intronic
1180158759 21:45989918-45989940 CCCCTCCATCTGGAAGGACAAGG + Intronic
1181044793 22:20209442-20209464 CCCCTCCAAAAGAAAGGTGTTGG + Intergenic
1181571364 22:23769353-23769375 CCCCTCCATAAGGAAGGAGCAGG + Intronic
1183082835 22:35467848-35467870 CTCAGCCAGAAGGAAGGAGCAGG - Intergenic
1183282903 22:36942180-36942202 ACACTACATAAGGAAGGAGCAGG + Intergenic
1183708464 22:39489024-39489046 CCCCTCAAGAACCAAGGAGCCGG - Exonic
1184650997 22:45919434-45919456 CCCATGCATCAGGAAGGAACAGG + Intergenic
1184745054 22:46451256-46451278 CCGCCCCACAAGGAGGGAGCTGG + Intronic
1185004554 22:48268060-48268082 CCCGGCCATGAGGAAGGAGGAGG + Intergenic
954089982 3:48276612-48276634 CCCCGCCATAAGCAAGGCACGGG - Intronic
956411533 3:68984831-68984853 CCAGTCCATCAGGAAGGGGCAGG - Intronic
963291363 3:143493221-143493243 GCTTTGCATAAGGAAGGAGCAGG + Intronic
971342166 4:25780562-25780584 ACATTCCAGAAGGAAGGAGCAGG - Intronic
971504272 4:27348806-27348828 CCCATCCATAAGGAAGGTTCTGG + Intergenic
972159710 4:36208564-36208586 CCACTGCATAAGGAAGGGGTAGG + Intronic
972398182 4:38674826-38674848 CTCCTCCCTCAGGAAGGGGCAGG + Intronic
984377908 4:178955335-178955357 CCCCTCATTGAGGAAGGAGTGGG + Intergenic
984602015 4:181738721-181738743 CCCCTCCATAATTTAGGAGGGGG - Intergenic
984654775 4:182305995-182306017 ACCGTCCATATGGGAGGAGCTGG + Intronic
985024727 4:185729451-185729473 CAGCTCCATAAGGACGAAGCAGG - Intronic
985481116 5:111451-111473 GCCCGACATAAGGAAGGAGATGG - Intergenic
985658876 5:1145761-1145783 CCTCTGCAGAAGGAAGGGGCTGG + Intergenic
986037296 5:3952435-3952457 CCCCTCCATATGGGATGAGTAGG + Intergenic
989717849 5:44485605-44485627 CCCATTCATTAGCAAGGAGCTGG + Intergenic
993900085 5:93579327-93579349 CTCCTCCGGAAGGAAGGAGGAGG - Intergenic
995707969 5:115004741-115004763 CCATTCCAGAAGGAAGGAACAGG - Intergenic
997092190 5:130871028-130871050 TCCCTCCCTCAGGAAGAAGCTGG - Intergenic
997951194 5:138243900-138243922 CCCCTCCATAGGGGAAGAGAGGG - Intergenic
998057282 5:139088919-139088941 CCCCTACAAAAGGAAGGGGGAGG - Intronic
1000298503 5:159934075-159934097 CCACTCAAGAAGCAAGGAGCTGG + Intronic
1001452654 5:171838205-171838227 GCCTCCCAAAAGGAAGGAGCGGG - Intergenic
1003921343 6:10836161-10836183 CCCCTCAAACAGAAAGGAGCTGG - Intronic
1004867468 6:19868459-19868481 CCCCACCTTCAGCAAGGAGCTGG + Intergenic
1005839654 6:29734170-29734192 CCCCAGCTGAAGGAAGGAGCTGG - Intronic
1006392969 6:33769657-33769679 CTCCCCCAAAAGGAAGGCGCGGG - Intergenic
1009938929 6:70267215-70267237 CTCCACCATCAGGAAGGAGGTGG - Intronic
1014018498 6:116562377-116562399 CCCCTCCACGAGAAAGGAGAGGG + Intergenic
1015771645 6:136774014-136774036 TCTCTCCATAAGGAAGGGGTAGG - Intronic
1017781683 6:157720388-157720410 CCCCTCCCTCAGGAAGGCCCTGG + Intronic
1018170263 6:161138844-161138866 CCCCGCCAGAGGCAAGGAGCAGG + Intronic
1022657209 7:32330632-32330654 CCCCTGCTTAAGTAAGGAGCTGG + Intergenic
1030020447 7:105270338-105270360 CCCCTCATTTTGGAAGGAGCAGG + Intronic
1033845584 7:145427950-145427972 CCCATCTAGAAGGAAGGAGATGG + Intergenic
1033896922 7:146083478-146083500 ACCCTCTATAAGGAAGGAGAAGG + Intergenic
1035948346 8:3990772-3990794 CCCTTTCATGAGGAAGGAGAGGG + Intronic
1037020041 8:13958895-13958917 CCCCACCATCCTGAAGGAGCTGG + Intergenic
1047073934 8:121378600-121378622 ACACTCCATAAGGTGGGAGCAGG - Intergenic
1048361469 8:133700737-133700759 CCCGTCCACAAGGAATAAGCAGG - Intergenic
1048688080 8:136926728-136926750 CCCCTCCAAAAGTAAGTATCTGG - Intergenic
1049363787 8:142226755-142226777 TCCCGGCATAAGGAAGCAGCAGG + Intronic
1049609894 8:143550020-143550042 CCCCTGCATAAGAAAAGAGCTGG - Intergenic
1049830063 8:144694818-144694840 TCCCTCCTTATGGAAGGAGAAGG - Intergenic
1051361948 9:16288888-16288910 CACCTCCACAAGGAAGCAACAGG + Intergenic
1052036077 9:23682561-23682583 CCCTTCAAAGAGGAAGGAGCTGG + Intergenic
1053428395 9:38026050-38026072 CCCCTTCCCAAGGAAGGATCAGG + Intronic
1057431736 9:95001090-95001112 CCCCTCCATGAAGTAGAAGCAGG + Intronic
1060223311 9:121775599-121775621 CCCAACCATCAGGGAGGAGCAGG - Intronic
1061478499 9:130884778-130884800 CTCCCCCACAAGGAAGAAGCTGG + Exonic
1062362927 9:136196022-136196044 CCCCTCCATCAGGAAGGGATGGG + Intergenic
1186977761 X:14926571-14926593 CCCCACTAAAAGGAAGTAGCTGG - Intergenic
1187775951 X:22757561-22757583 CCCCTCCTTAAGGCAGGTCCAGG - Intergenic
1192261234 X:69506757-69506779 CCCCTGACAAAGGAAGGAGCTGG + Intronic
1195094190 X:101490081-101490103 ACCATGCCTAAGGAAGGAGCTGG + Exonic
1196540087 X:116897840-116897862 CCCCTGCACAAAGAAAGAGCTGG - Intergenic
1196780260 X:119377255-119377277 CCAGTCCATAAGGAATGTGCTGG + Intergenic
1200071583 X:153531928-153531950 CTCCTCCATAAAGGCGGAGCAGG + Intronic
1202368180 Y:24180740-24180762 CAGCTCCAGAAGGAAGGGGCAGG + Intergenic
1202372517 Y:24208442-24208464 CAGCTCCAGAAGGAAGGGGCAGG - Intergenic
1202502605 Y:25489377-25489399 CAGCTCCAGAAGGAAGGGGCAGG - Intergenic