ID: 1181571451

View in Genome Browser
Species Human (GRCh38)
Location 22:23769756-23769778
Sequence AACTCTCTGCAGTTTAGGCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181571451_1181571458 26 Left 1181571451 22:23769756-23769778 CCGGGCCTAAACTGCAGAGAGTT No data
Right 1181571458 22:23769805-23769827 ACTGCAGGTTCCACAAAGCATGG No data
1181571451_1181571455 11 Left 1181571451 22:23769756-23769778 CCGGGCCTAAACTGCAGAGAGTT No data
Right 1181571455 22:23769790-23769812 TCCCATGGCTGATGGACTGCAGG No data
1181571451_1181571453 -4 Left 1181571451 22:23769756-23769778 CCGGGCCTAAACTGCAGAGAGTT No data
Right 1181571453 22:23769775-23769797 AGTTGTTACTTCAGCTCCCATGG No data
1181571451_1181571454 3 Left 1181571451 22:23769756-23769778 CCGGGCCTAAACTGCAGAGAGTT No data
Right 1181571454 22:23769782-23769804 ACTTCAGCTCCCATGGCTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181571451 Original CRISPR AACTCTCTGCAGTTTAGGCC CGG (reversed) Intronic