ID: 1181573736

View in Genome Browser
Species Human (GRCh38)
Location 22:23781357-23781379
Sequence CCTCGAAGGCAGCGTCCACA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 82}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181573736_1181573745 8 Left 1181573736 22:23781357-23781379 CCCTGTGGACGCTGCCTTCGAGG 0: 1
1: 0
2: 1
3: 5
4: 82
Right 1181573745 22:23781388-23781410 GGCCACATTTGGTTCTTCCAAGG 0: 1
1: 0
2: 0
3: 11
4: 124
1181573736_1181573742 -3 Left 1181573736 22:23781357-23781379 CCCTGTGGACGCTGCCTTCGAGG 0: 1
1: 0
2: 1
3: 5
4: 82
Right 1181573742 22:23781377-23781399 AGGATGCCCAGGGCCACATTTGG 0: 1
1: 0
2: 5
3: 16
4: 199
1181573736_1181573751 22 Left 1181573736 22:23781357-23781379 CCCTGTGGACGCTGCCTTCGAGG 0: 1
1: 0
2: 1
3: 5
4: 82
Right 1181573751 22:23781402-23781424 CTTCCAAGGTGAGTGGGGGTTGG 0: 1
1: 0
2: 1
3: 27
4: 252
1181573736_1181573753 24 Left 1181573736 22:23781357-23781379 CCCTGTGGACGCTGCCTTCGAGG 0: 1
1: 0
2: 1
3: 5
4: 82
Right 1181573753 22:23781404-23781426 TCCAAGGTGAGTGGGGGTTGGGG 0: 1
1: 0
2: 5
3: 27
4: 358
1181573736_1181573748 16 Left 1181573736 22:23781357-23781379 CCCTGTGGACGCTGCCTTCGAGG 0: 1
1: 0
2: 1
3: 5
4: 82
Right 1181573748 22:23781396-23781418 TTGGTTCTTCCAAGGTGAGTGGG 0: 1
1: 0
2: 0
3: 18
4: 154
1181573736_1181573749 17 Left 1181573736 22:23781357-23781379 CCCTGTGGACGCTGCCTTCGAGG 0: 1
1: 0
2: 1
3: 5
4: 82
Right 1181573749 22:23781397-23781419 TGGTTCTTCCAAGGTGAGTGGGG 0: 1
1: 0
2: 3
3: 53
4: 266
1181573736_1181573752 23 Left 1181573736 22:23781357-23781379 CCCTGTGGACGCTGCCTTCGAGG 0: 1
1: 0
2: 1
3: 5
4: 82
Right 1181573752 22:23781403-23781425 TTCCAAGGTGAGTGGGGGTTGGG 0: 1
1: 0
2: 2
3: 21
4: 190
1181573736_1181573747 15 Left 1181573736 22:23781357-23781379 CCCTGTGGACGCTGCCTTCGAGG 0: 1
1: 0
2: 1
3: 5
4: 82
Right 1181573747 22:23781395-23781417 TTTGGTTCTTCCAAGGTGAGTGG 0: 1
1: 0
2: 2
3: 14
4: 188
1181573736_1181573750 18 Left 1181573736 22:23781357-23781379 CCCTGTGGACGCTGCCTTCGAGG 0: 1
1: 0
2: 1
3: 5
4: 82
Right 1181573750 22:23781398-23781420 GGTTCTTCCAAGGTGAGTGGGGG 0: 1
1: 0
2: 0
3: 9
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181573736 Original CRISPR CCTCGAAGGCAGCGTCCACA GGG (reversed) Exonic
901137946 1:7009757-7009779 CCTCTAAGGCAGCTTGGACATGG + Intronic
902575099 1:17372626-17372648 CCCCGAGGCCAGCGTCCCCATGG - Intronic
903227804 1:21903773-21903795 CCTCCAAGGCAGAGACCACATGG - Intronic
906613269 1:47218173-47218195 CCTCGAAGGCAGAGCCTAGAGGG + Exonic
909189939 1:72539109-72539131 CTTCTATGGCAGCTTCCACAAGG + Intergenic
913091663 1:115480297-115480319 CCTCACAGGCAGCCTCCAGAAGG - Intergenic
920076531 1:203341370-203341392 CCACAAAGGTAGCGGCCACATGG - Exonic
921954443 1:220967545-220967567 CCCTGAAGGCAGCCTCCAGAAGG - Intergenic
1063730976 10:8696825-8696847 CCATGAATGCAGCGACCACAAGG + Intergenic
1065811599 10:29448397-29448419 CCTCAATGGCAGCGTGCAGAGGG - Intergenic
1069901771 10:71710586-71710608 CCTGGAAGGGAGGGTCCACAGGG + Intronic
1071774520 10:88770319-88770341 ACTCGAATGCAGTGTACACATGG + Intronic
1077378681 11:2217708-2217730 CTTCCAAGGCTGGGTCCACAGGG - Intergenic
1078759984 11:14244058-14244080 CCCAGAAGGCAGAATCCACAGGG - Intronic
1084046244 11:66569352-66569374 CCACTAAGGCAGGGTGCACAGGG + Intergenic
1084337863 11:68471580-68471602 CCTGGAAGGGAGCATTCACAAGG + Intronic
1085109713 11:73876858-73876880 CCTCGTGGGGAGCGTGCACACGG + Exonic
1085457611 11:76674133-76674155 CCTAGAAGGCAGGGCCCAGAAGG - Intergenic
1095170391 12:39027991-39028013 CCTCTAAGTCAGCCTCCAGATGG - Intergenic
1096480859 12:51940030-51940052 CCTCAAAGGCAGGGTGTACATGG + Intergenic
1105001898 12:132695480-132695502 CCTAGAAGGCAGGCTCCACAAGG - Intronic
1105474947 13:20721246-20721268 CCCCGAGGGGAGCGTCCACCTGG - Intronic
1108100057 13:46944970-46944992 TCAAGAAGGCAGCTTCCACATGG - Intergenic
1119726479 14:76924705-76924727 CCTCTAAGGCAGCGACCACGTGG - Intergenic
1129618497 15:77120660-77120682 CCTCGAATACATCTTCCACATGG + Intronic
1132313880 15:100877274-100877296 CCTCAGAGGCAGGGACCACAGGG - Intergenic
1132956779 16:2598459-2598481 CCTCGATGGCACCCTCCACTCGG - Exonic
1137784782 16:51129346-51129368 CCTCGTAGGCTGCTTCCACTTGG - Intergenic
1139371931 16:66474359-66474381 CCTCCAAGGCATTCTCCACAAGG + Intronic
1140198943 16:72879004-72879026 CCTCGAGGGCAGCCTCCACAGGG - Intronic
1141156659 16:81601727-81601749 CATGGAAGGCAGCGTCCCCCGGG + Intronic
1145059707 17:19724849-19724871 CCCCGAGGGCAGGGTCCACGGGG - Intergenic
1146492023 17:33290472-33290494 CCTCCAAGGCAGACTGCACAAGG + Intronic
1148505831 17:48126393-48126415 CATGGGAGGCAGCGTCGACAGGG + Intergenic
1152626138 17:81388707-81388729 CCCTGAAGGCAGCTTCCACCAGG - Intergenic
1156242607 18:35268019-35268041 GCTCGAGGGCAGAGTCCACCAGG - Intronic
1164522668 19:28990895-28990917 CCTCGCAGTCAGTGTGCACAGGG - Intergenic
1164625803 19:29727081-29727103 CCCAGAAGGCAGGCTCCACAAGG + Intergenic
1165614065 19:37183139-37183161 CCTGGAAGCAAGCATCCACATGG + Exonic
1167477720 19:49710562-49710584 CCACAATGGCAGCGACCACAAGG - Intronic
927051389 2:19333003-19333025 CCTAGAAGACAGATTCCACAAGG + Intergenic
927698617 2:25253282-25253304 CCTCGAGGGCAGAGCCAACAGGG - Intronic
946381983 2:219355050-219355072 CCTCGAAGACAGCATCCACGTGG - Intergenic
948224010 2:236294649-236294671 CTCCCAAGGCAGCGTCCACTGGG + Intergenic
948468022 2:238161442-238161464 CCTCAAAGGCAGCTCCCAAAGGG - Intronic
1168773237 20:429130-429152 CCTCTAAGGCAAAGCCCACAAGG - Intronic
1170056702 20:12213166-12213188 CCTCTAAGGCTGGGTCCCCATGG - Intergenic
1174092774 20:48062694-48062716 CCTGGATGGCTGAGTCCACATGG - Intergenic
1175948387 20:62569371-62569393 ACACTAAGGCAGCGGCCACAGGG + Intronic
1177078346 21:16607006-16607028 CCTCAAAGGCAGCAGCCTCAAGG + Intergenic
1181573736 22:23781357-23781379 CCTCGAAGGCAGCGTCCACAGGG - Exonic
1182363065 22:29758919-29758941 CCTCCATGGCAGCCTCCAGAGGG - Intronic
1183717133 22:39540107-39540129 TCTCGAAGGCTGAGCCCACAGGG - Intergenic
950106685 3:10393084-10393106 CCTGGAGGGCAGGGACCACAGGG - Intronic
950139317 3:10604305-10604327 TCTCCAAGCCAGCCTCCACATGG + Intronic
952062106 3:29523476-29523498 TCTGGAAAGCAGCATCCACAGGG + Intronic
957631167 3:82717281-82717303 CCTCAAAGGCTGCCTCCAGAGGG - Intergenic
965786651 3:172342199-172342221 CCTCACAGGCAGTGTCTACATGG - Intronic
966208182 3:177425822-177425844 CCTCTAATCCAGCATCCACACGG - Intergenic
969042644 4:4312730-4312752 CCACCAAAGCAGCCTCCACAGGG + Intronic
970582058 4:17482536-17482558 ACTCCAAGGCAGCATTCACAGGG + Intronic
972614223 4:40682834-40682856 CCTTGAAGGTTGAGTCCACATGG + Intergenic
982678331 4:158400856-158400878 ACTAGAAGGCAGGGTACACAGGG + Intronic
989243909 5:39231870-39231892 CTTCAAAGGCATCATCCACAAGG - Intronic
992093431 5:73339313-73339335 CCACGATGTCAGCGTCCCCAAGG - Intergenic
992894335 5:81233484-81233506 CCTCGCAGTCAGCGTCCTAACGG - Intronic
997702437 5:135912156-135912178 CCTCTGAGGCAGCTTCCATATGG + Intergenic
1001396234 5:171420979-171421001 CCTCGCGGGCAGCGGCCACTCGG - Intronic
1013074958 6:106763210-106763232 CCTGGAAGGCAGTGTGCCCAGGG + Intergenic
1019920492 7:4160342-4160364 CCTCCAGGGCAGCATCCAAAAGG + Intronic
1019929239 7:4212607-4212629 CCTCGAAGGCAGCCTCGTCCAGG - Intronic
1021839299 7:24709537-24709559 CCTCCAAGCCAGCGCGCACACGG + Intronic
1023984358 7:45086248-45086270 CCTCAAACGCAGCGTGCAGAGGG - Intronic
1030006310 7:105124085-105124107 GCTGGAAGGCAGCTTCCACGTGG - Intronic
1042866393 8:73359924-73359946 CTTAGAAGGCAGAGTCCAAAGGG - Intergenic
1044222536 8:89686178-89686200 CCTCTAAGCCAGTCTCCACATGG - Intergenic
1049500194 8:142958933-142958955 CCCCGAAGGCAGAGACCAAAAGG - Intergenic
1049651510 8:143771908-143771930 CGTCGAAGGCGGCGTCCAGCAGG - Intergenic
1056383592 9:86077555-86077577 GCTGGAAGGCAGGGTCCGCAGGG - Exonic
1057191870 9:93092882-93092904 CTTGGAAGGCAGAGCCCACAGGG + Intergenic
1057801878 9:98195831-98195853 CCTGGAAGGCAGCAGCCCCAGGG + Intergenic
1058951142 9:109905287-109905309 CCTCGATGGCTGAGTCCACCTGG - Intronic
1061723079 9:132565725-132565747 CCAGGAAGGCAGAGCCCACATGG - Intronic
1062628237 9:137452562-137452584 CCTCGAAGGTTGCGTGCTCATGG + Exonic
1203791384 EBV:153597-153619 CCGTGAAGGCAGGGTCCCCATGG - Intergenic
1185890259 X:3816182-3816204 CCTCCCAGGCAGCGACCGCAGGG - Intergenic
1191105677 X:56770705-56770727 CCTGGAAGGCAGGGTCGACTGGG + Intergenic
1191106670 X:56776107-56776129 CCTGGAAGGCAGGGTCGACTGGG + Intergenic
1201980861 Y:19909003-19909025 GCTGCAAGGCAGCGCCCACACGG - Intergenic