ID: 1181574892

View in Genome Browser
Species Human (GRCh38)
Location 22:23787365-23787387
Sequence GGGCGCGCGCGCGCGCGCTC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 522
Summary {0: 1, 1: 2, 2: 23, 3: 93, 4: 403}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181574882_1181574892 11 Left 1181574882 22:23787331-23787353 CCGAGAGCGCGCGTCTCCATTCA 0: 1
1: 0
2: 0
3: 2
4: 51
Right 1181574892 22:23787365-23787387 GGGCGCGCGCGCGCGCGCTCGGG 0: 1
1: 2
2: 23
3: 93
4: 403
1181574878_1181574892 30 Left 1181574878 22:23787312-23787334 CCCGGGGCGGGCCCATGCGCCGA 0: 1
1: 0
2: 0
3: 4
4: 75
Right 1181574892 22:23787365-23787387 GGGCGCGCGCGCGCGCGCTCGGG 0: 1
1: 2
2: 23
3: 93
4: 403
1181574879_1181574892 29 Left 1181574879 22:23787313-23787335 CCGGGGCGGGCCCATGCGCCGAG 0: 1
1: 0
2: 0
3: 6
4: 77
Right 1181574892 22:23787365-23787387 GGGCGCGCGCGCGCGCGCTCGGG 0: 1
1: 2
2: 23
3: 93
4: 403
1181574890_1181574892 -5 Left 1181574890 22:23787347-23787369 CCATTCATCGGGGCGGGCGGGCG 0: 1
1: 0
2: 0
3: 5
4: 40
Right 1181574892 22:23787365-23787387 GGGCGCGCGCGCGCGCGCTCGGG 0: 1
1: 2
2: 23
3: 93
4: 403
1181574880_1181574892 19 Left 1181574880 22:23787323-23787345 CCCATGCGCCGAGAGCGCGCGTC 0: 1
1: 0
2: 0
3: 1
4: 13
Right 1181574892 22:23787365-23787387 GGGCGCGCGCGCGCGCGCTCGGG 0: 1
1: 2
2: 23
3: 93
4: 403
1181574881_1181574892 18 Left 1181574881 22:23787324-23787346 CCATGCGCCGAGAGCGCGCGTCT 0: 1
1: 0
2: 0
3: 4
4: 185
Right 1181574892 22:23787365-23787387 GGGCGCGCGCGCGCGCGCTCGGG 0: 1
1: 2
2: 23
3: 93
4: 403

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181574892 Original CRISPR GGGCGCGCGCGCGCGCGCTC GGG Intronic
900180390 1:1308574-1308596 GGCCGCGTCCGCGCGCGCGCAGG + Exonic
900207977 1:1439713-1439735 GGGCGCGGGCGCGGGCCGTCGGG - Exonic
901506515 1:9689228-9689250 CGGCGCGCGCACGCTGGCTCTGG - Intronic
901628968 1:10639007-10639029 GGGCGCGGGCGCGCGGACCCCGG - Exonic
901660147 1:10794197-10794219 GTGCGCGCGCGCGCGCGTCGTGG + Intronic
901934453 1:12618045-12618067 TCGCGCGCGCTCGCTCGCTCCGG + Intergenic
902501446 1:16914148-16914170 GGGGGCGCGCGCGTGCGCGGGGG + Intronic
903034770 1:20486405-20486427 GGGCGGGCGCGCACCAGCTCCGG - Intergenic
903750340 1:25617245-25617267 GGCCGGGTGTGCGCGCGCTCGGG + Intergenic
903795121 1:25922923-25922945 GGGCGCGGCCGCGTGCGCCCGGG - Intergenic
904074717 1:27831253-27831275 GGGCTGGCTCGAGCGCGCTCGGG - Intronic
904181349 1:28668858-28668880 GGGCGCGCGGGCGCGGGGTGGGG + Intronic
904563391 1:31413318-31413340 CGGCGCGCGCGGGCGGGCGCCGG - Intronic
904769031 1:32870808-32870830 GGCCGCTCGCGCTCGCGCTCCGG + Exonic
904837733 1:33349842-33349864 GGTTGCGCGCGCGCGCGCGGCGG + Intronic
904847475 1:33430948-33430970 GGGCGGGCGCGTGCGCGCTGGGG - Intronic
906140362 1:43530831-43530853 GGGCGCGGGCGCGAGCGCGAGGG + Intronic
906204333 1:43979171-43979193 GGCCGCGGGGGCGCGCGCGCGGG + Intronic
906204336 1:43979179-43979201 GGGCGCGCGCGCGGGCGCGCGGG + Intronic
906204337 1:43979183-43979205 GCGCGCGCGGGCGCGCGGGCCGG + Intronic
907200928 1:52726413-52726435 AGGCGCGGGCTCGCGCGCCCGGG + Intergenic
907364282 1:53946318-53946340 AGGCGCGCGTGCGCGGGCCCCGG - Exonic
907526476 1:55056863-55056885 GTGCGTGCGCGCGCGCGCGTTGG + Intronic
907526478 1:55056865-55056887 GCGTGCGCGCGCGCGCGTTGGGG + Intronic
908561297 1:65309480-65309502 GGGCGGGGGCGCGCGTCCTCTGG - Intronic
910533951 1:88275030-88275052 GCGCGCGCGCGCGCGCGCCTGGG + Intergenic
911072924 1:93846739-93846761 GGCCCCGGGCGCGCGGGCTCGGG + Intronic
912684243 1:111749444-111749466 GTGCGCGCGCGCGCGTGCTAGGG + Intronic
914393449 1:147242614-147242636 GGGCGCGCGACTGCGCGCTGGGG - Intronic
914869118 1:151458807-151458829 GAGTGCGCGCGCGCGCGCCGCGG + Intronic
917565382 1:176207269-176207291 GTGCGCGCGCGCGCGAGCGGCGG + Exonic
919640549 1:200040797-200040819 GGCGGCGCGCCCGGGCGCTCAGG + Intronic
920278839 1:204828599-204828621 GGGCGCGGGGGCGCGCACGCAGG + Intergenic
920600601 1:207320872-207320894 GCGCGCGCGCGCGCGCGCCTCGG - Intergenic
922831531 1:228556784-228556806 GCGCGCGTGCGAGCGCGCCCGGG - Intergenic
922832009 1:228608738-228608760 GCGCGCGTGCGAGCGCGCCCGGG - Intergenic
922832570 1:228610979-228611001 GCGCGCGTGCGAGCGCGCCCGGG - Intergenic
922833130 1:228613220-228613242 GCGCGCGTGCGAGCGCGCCCGGG - Intergenic
922833691 1:228615461-228615483 GCGCGCGTGCGAGCGCGCCCGGG - Intergenic
922834250 1:228617702-228617724 GCGCGCGTGCGAGCGCGCCCGGG - Intergenic
922835359 1:228622158-228622180 GCGCGCGTGCGAGCGCGCCCGGG - Intergenic
922835918 1:228624378-228624400 GCGCGCGTGCGAGCGCGCCCGGG - Intergenic
922836477 1:228626620-228626642 GCGCGCGTGCGAGCGCGCCCGGG - Intergenic
922837035 1:228628859-228628881 GCGCGCGTGCGAGCGCGCCCGGG - Intergenic
922837594 1:228631101-228631123 GCGCGCGTGCGAGCGCGCCCGGG - Intergenic
922838153 1:228633342-228633364 GCGCGCGTGCGAGCGCGCCCGGG - Intergenic
922838712 1:228635581-228635603 GCGCGCGTGCGAGCGCGCCCGGG - Intergenic
922839270 1:228637807-228637829 GCGCGCGTGCGAGCGCGCCCGGG - Intergenic
922840392 1:228642279-228642301 GCGCGCGTGCGAGCGCGCCCGGG - Intergenic
922958558 1:229625815-229625837 GCGCGCGCGCGCGGGCGGGCGGG - Intronic
922958560 1:229625819-229625841 AGGCGCGCGCGCGCGCGGGCGGG - Intronic
923191709 1:231626668-231626690 GCGCGCGCGCGCGCGCGTCAGGG + Intronic
924527466 1:244864620-244864642 GGCCGAGCGCGGGCGCGCTCCGG - Intergenic
1065025065 10:21534017-21534039 GGGCGCGGGGGCGCGCACGCGGG - Intergenic
1065099906 10:22321894-22321916 GGGCGCGCGCTCGCGGGCGCGGG - Intronic
1065214697 10:23438876-23438898 GCGCGCGAGCGCGCGCGGGCGGG - Intergenic
1065968083 10:30784960-30784982 GGGGGCGCCCGGGCGAGCTCGGG - Intergenic
1066464396 10:35640319-35640341 GGGCGCGGGCGCGGGCGGCCCGG - Exonic
1066665673 10:37780698-37780720 GGGCACGTGCGCGCGCGTCCAGG - Intronic
1068545078 10:58335444-58335466 GGGCCCGCGCGCGTTCGCGCCGG + Intronic
1069403632 10:68075352-68075374 GGGCTCGCGCGCGTGCTCTGCGG - Intergenic
1069662495 10:70132743-70132765 GCGCCCGCGCGCTCTCGCTCCGG + Exonic
1069913597 10:71774032-71774054 GTGCGCGCGCGCATGCACTCAGG - Intronic
1070257772 10:74826043-74826065 GGGCGCGGGCGGGCGCGCGCGGG - Intronic
1071086828 10:81875248-81875270 GCGGGCGCGGGCGCGGGCTCCGG - Intergenic
1071997569 10:91163012-91163034 GTGCGCGAGCGCGCGCGCGTGGG - Intronic
1072591564 10:96832544-96832566 GGTCGCGCGCGCTCACACTCCGG - Intronic
1073463755 10:103681757-103681779 GTGTGTGCGCGCGCGCGCGCGGG - Intronic
1074810204 10:117096994-117097016 GTGCGCGCGCGTGCGCGCTTGGG - Intronic
1076707287 10:132308638-132308660 GAGCGCGGGCGCACGTGCTCAGG - Intronic
1076976969 11:180302-180324 GGGCGGGATCGCGCGCCCTCTGG + Intronic
1077053162 11:576727-576749 GCGGGCGGGCGCGCGCGCGCTGG + Intronic
1077177653 11:1197941-1197963 GGGATCGCGCGGGCGCCCTCAGG - Intronic
1077214620 11:1390237-1390259 GGGCGCCCGGGCGCGCGGGCAGG - Intronic
1082959571 11:58905788-58905810 GGGCGCACGCGCTCGCGGGCGGG - Intronic
1083317871 11:61827724-61827746 GGGCGTGCGCGCACGCGCCCCGG + Intronic
1083657104 11:64234904-64234926 GGGCGGGCGGGCGCGCTGTCGGG - Intronic
1083753638 11:64777871-64777893 AGGGGCGCGCGTGCGCGCACGGG - Intronic
1083843055 11:65315437-65315459 GGGCCCGCACGCCCGAGCTCTGG + Intronic
1083933232 11:65857372-65857394 CGGCGCGTGCGCGCACGCTCAGG - Intronic
1083970244 11:66070189-66070211 GGGCGCGAGCGCGCCCGGCCCGG + Intergenic
1084146153 11:67266429-67266451 GGGCGCGGGCGCGCGGGCGGCGG + Exonic
1085165883 11:74398726-74398748 GGGGGCCTGCGCGCGCGCTGGGG - Intergenic
1087141441 11:94768892-94768914 GCGCGCCCGCGCCCGCGCGCGGG + Intronic
1088820483 11:113452472-113452494 GCGCGCGCGCGCGCGCACATTGG + Intronic
1089713671 11:120336325-120336347 GCGGGCGCGCGCGCGGGTTCCGG - Intergenic
1089977444 11:122744897-122744919 GTGCGCGCGCGCGCGCACTTGGG + Intronic
1090029729 11:123196158-123196180 GGGCCTGCGCGCCCGGGCTCCGG + Intergenic
1091402450 12:189201-189223 AGGCGCGCGCCCGCGTGCTAGGG + Intergenic
1092045941 12:5431977-5431999 GGGCGCGGGCGCGCGCGGCGCGG + Intergenic
1092196967 12:6555540-6555562 GGGCTCGCCCGCGCGCTCCCCGG - Exonic
1092655044 12:10674872-10674894 GTGCGCGCGCGCGCGCGCGCGGG - Intergenic
1092843344 12:12562962-12562984 GGGGGCGGGCGCGCGGGCGCGGG - Intergenic
1092899369 12:13044371-13044393 GCGGGCGCGCGCACGCGCACCGG + Exonic
1092899371 12:13044373-13044395 GGGCGCGCGCACGCGCACCGGGG + Exonic
1093435323 12:19129669-19129691 GGGCGCGCGCGGGGGCGCGCCGG + Intergenic
1093711725 12:22335312-22335334 GGGCGCGCGCGCACACACACGGG - Intronic
1093728722 12:22544264-22544286 GAGCGCGCGGGGGCGCGCGCGGG + Intronic
1093958696 12:25250615-25250637 GGGGGCGCGGGCGCGGGGTCGGG - Intronic
1094041710 12:26126101-26126123 GGGCGAGCGCGCGCGCGCACGGG - Intronic
1095799390 12:46256594-46256616 GTGCGCGCGCGCGCGCAAACTGG - Intronic
1096101298 12:48971836-48971858 GCGCGCGCGCGCGCGCGCGCTGG - Intergenic
1096482395 12:51951536-51951558 GCGGGCGCCCGCGCGCGCCCCGG + Intergenic
1096482447 12:51951678-51951700 GGGGGCGCGCGCGCGCGCGCTGG + Intronic
1096710628 12:53452625-53452647 GGGAGGGCGCGCGCGCGGTAGGG + Intronic
1096994616 12:55830810-55830832 GCGCGCGCGTGCGCGCGGTGGGG - Intronic
1096994618 12:55830812-55830834 GCGCGCGCGCGTGCGCGCGGTGG - Intronic
1098161067 12:67648731-67648753 GCGCGGGGGCGCGCGCGCGCGGG + Exonic
1098161069 12:67648737-67648759 GGGCGCGCGCGCGCGGGCCCGGG + Exonic
1098255373 12:68610828-68610850 GGGCGCGCGGGTGCGCGGCCCGG - Exonic
1098350782 12:69557618-69557640 GTGCGCGCGCGCGCGCGCGCAGG + Intronic
1099989784 12:89709397-89709419 GTGCGCGCGCGCGCGCGCGGAGG + Intergenic
1100869398 12:98894871-98894893 GGGGGCGCGCGCGCGGGCCCGGG - Intronic
1101354716 12:103966119-103966141 TGGCGCGCGCGCGCGCACGCAGG + Intronic
1101354718 12:103966121-103966143 GCGCGCGCGCGCGCACGCAGGGG + Intronic
1101641257 12:106586979-106587001 GTGCGCGCGCGCGGGCGAACGGG + Intronic
1102084395 12:110124283-110124305 GCGCGCGCGCGCACGAGCTGGGG - Intergenic
1103363867 12:120368930-120368952 GGGGGCGCGGGCCCGGGCTCCGG + Intronic
1103758817 12:123233134-123233156 GGGCGCGCGCGCGCTCCCTCGGG - Exonic
1103800359 12:123533755-123533777 GGGAGGGCGCGCGCGTGCGCAGG + Intergenic
1103856369 12:123973246-123973268 GAGCGCGCGCGCGCGCGGCTCGG + Exonic
1104568285 12:129903899-129903921 GCTCGGGCGCGCGCGCGCTCCGG + Intergenic
1104961407 12:132490089-132490111 GGGCGCGCGGGCGCCCGCGGCGG + Exonic
1104961570 12:132490588-132490610 GCGCGCGCGAGCGCCGGCTCGGG - Exonic
1105243564 13:18628485-18628507 GGGGACGCGCGCGCACGCTCGGG - Intergenic
1105964592 13:25372574-25372596 GGGCGCACGGGCACGCGCACAGG - Intronic
1106340127 13:28819830-28819852 GGGCGGGCAGGCGCGCGCGCAGG + Intergenic
1106735670 13:32586290-32586312 GGACGTGCGCGCGCGCGGACGGG + Intergenic
1107654058 13:42574149-42574171 GGGCGCGCGGGCGAGCGGGCAGG - Exonic
1108408083 13:50124567-50124589 GAGAGCGCGCGCGCGGGCTTCGG - Intronic
1110922491 13:81106116-81106138 GTGTGCGCGCGTGCGCGCACAGG - Intergenic
1111951290 13:94711437-94711459 AGGCGCCCGCGCCCGCGGTCGGG + Exonic
1112216244 13:97434075-97434097 GGGCGCGCGCTCGAGCGCTGGGG + Intergenic
1112507039 13:99981601-99981623 GTGCGCGCGCGGGTGCGCGCAGG + Intergenic
1113379259 13:109787147-109787169 GGGCGGCCGCTCCCGCGCTCGGG + Intergenic
1113517387 13:110914378-110914400 GCGCGCGCGCGCGCTCGCACAGG + Intronic
1113655609 13:112066666-112066688 GCCGCCGCGCGCGCGCGCTCAGG + Intergenic
1113737709 13:112690157-112690179 GGGGCCGCGCGCGCGCGCTCTGG - Intergenic
1117721910 14:58637226-58637248 GTGCGCGCGCGTGCGCGCTTTGG - Intronic
1118323157 14:64765036-64765058 GTGTGTGCGCGCGCGCGCGCGGG + Intronic
1119325275 14:73756296-73756318 GCGCGCGCGCGTGCGCGCTGAGG + Intronic
1119539318 14:75428255-75428277 GGGTGCGAGGGCGCGCGCTGGGG + Intronic
1120834582 14:89028021-89028043 GTGTGCGCGCGCGCGCGGACAGG - Intergenic
1120881059 14:89416120-89416142 GCGTGCGCGCGCGCGCGTGCTGG - Intronic
1120941772 14:89956183-89956205 GGGGGCGCGCACGGGCGCTGCGG + Intronic
1122265916 14:100546761-100546783 GTGCGCGCGCGCGCGCGCGCCGG - Intronic
1122275120 14:100587200-100587222 GGGCGCGGGCGCGGGCGCGGAGG - Intronic
1122779125 14:104136274-104136296 CGCCGCGCGCCCCCGCGCTCCGG - Intergenic
1123544224 15:21325204-21325226 GGAGACGCGCGCGCACGCTCGGG + Intergenic
1124427071 15:29571007-29571029 GGCGGCTCGCGCCCGCGCTCGGG - Intergenic
1124696929 15:31870935-31870957 GCGCGCCCGCGAGCCCGCTCCGG + Intergenic
1125201017 15:37100746-37100768 GCGCGCGCGCGCGCGCGAACAGG + Intronic
1125201111 15:37101355-37101377 GCGCGCGCGCACGGGCGCGCGGG - Intergenic
1126140094 15:45430407-45430429 GGGCGCCAGCGCCCGCGTTCGGG + Intergenic
1126766478 15:52016049-52016071 GCGCGCGCGCGCGCGCGCGATGG - Intronic
1126800838 15:52295475-52295497 GGGCGGGCGGGCGCGCGCTGGGG - Intronic
1127415135 15:58749925-58749947 GGGCGCGCGCATGCGCGCGGGGG + Exonic
1127931645 15:63600988-63601010 CGGCGGGCGCGCGCGGGCGCGGG - Intronic
1128791140 15:70434715-70434737 GTGTGCGCGCGCGCGCGCGCGGG - Intergenic
1129483074 15:75843280-75843302 GCGGCCGGGCGCGCGCGCTCTGG + Exonic
1129503207 15:76059798-76059820 GGGCGCGCGCGCGCGGCCGGCGG + Intergenic
1129612312 15:77070769-77070791 GGGGCCGCGCGCGGGCCCTCAGG - Intronic
1130348117 15:83067287-83067309 GTGCGGGGGCGCGCGCGGTCAGG - Exonic
1130849322 15:87778448-87778470 GCGCGCGCGCGCGTGCACACAGG - Intergenic
1131263627 15:90902988-90903010 GTGCGCGCGCGGGAGGGCTCCGG + Exonic
1132055548 15:98648510-98648532 TCGCGCGCGCGCGCGCGCCCTGG - Intergenic
1132527717 16:425898-425920 CGGCGCGGGCGGGCGCGCGCGGG - Exonic
1132926008 16:2429427-2429449 CGGGGCGCGGGCGCGCTCTCAGG + Exonic
1133513442 16:6483296-6483318 GCTCTCGCGCCCGCGCGCTCGGG + Intronic
1134438871 16:14285751-14285773 GGGCGCGCCCCGGCGGGCTCGGG - Intergenic
1136245796 16:28975119-28975141 GGCCGCGCCCGCCCGCGCTCCGG - Exonic
1137531760 16:49282403-49282425 GGGCGCGTGCGCGCGCGGCGGGG + Intergenic
1137617622 16:49856683-49856705 AGGGGCGCGCGGGGGCGCTCAGG + Intronic
1138229076 16:55324624-55324646 GAGAGTGCGCGCGCGCGCACGGG + Exonic
1138229077 16:55324628-55324650 GTGCGCGCGCGCGCACGGGCTGG + Exonic
1138539852 16:57681374-57681396 GTGCGCGCGTGCGTGCGCGCAGG + Intronic
1138956860 16:61981682-61981704 GCGCGCGCGCGCGTGCGCTTGGG + Intronic
1140462249 16:75148966-75148988 GGGCGCGCGCGCGCGGGACGAGG + Intronic
1141068473 16:80932556-80932578 GGCCGCGCGCGCGCACACGCCGG + Intergenic
1141116613 16:81315018-81315040 GGCCGGGCGGGCGCGCGCGCAGG + Exonic
1141463339 16:84191355-84191377 GGGCGCGGGCGCGGGCCCCCAGG - Exonic
1141647277 16:85374540-85374562 GTGTGCGCGCGCGCGTGCACAGG + Intergenic
1142299415 16:89247732-89247754 GGCCGCGGGCGCGCGGGGTCCGG + Intergenic
1142347077 16:89560888-89560910 GGGTGCGCGCGCCCGGGGTCCGG + Intronic
1142443291 16:90116368-90116390 GGGCGGGATCGCGCGCCCTCTGG - Intergenic
1142672050 17:1491831-1491853 GGGCGCGCGCGTGTTCGCTGTGG - Intronic
1142704230 17:1684410-1684432 GGGCGGGTGTGCGCGCGCGCAGG - Intronic
1143183492 17:4997906-4997928 GGACGCGCGAGCGCGCGCGGAGG - Intergenic
1143620981 17:8080113-8080135 CGAGGCGCGCGCGCGCCCTCTGG - Exonic
1143830421 17:9646075-9646097 CGGCGCTGGTGCGCGCGCTCTGG + Exonic
1144816597 17:18039597-18039619 GGGCGCGCACGCGCGGGGTGGGG - Exonic
1144847047 17:18225560-18225582 GGGCGCGGGCGCGCGGGGCCGGG - Intergenic
1144847050 17:18225563-18225585 GGCCCCGCGCGCCCGCGCCCGGG + Intergenic
1144971262 17:19111180-19111202 GGAGGCGTGCGCGCGCCCTCAGG - Intergenic
1144991568 17:19237351-19237373 GGACGCGTGCGCGCGCCCTCAGG - Exonic
1146033919 17:29390225-29390247 GCGCGCGCGCGCGCCCTCACAGG - Intergenic
1146053316 17:29568695-29568717 GGGCGCGCGCGCTCCCTCGCTGG + Exonic
1146403691 17:32519572-32519594 GGGCGTGTGCGCTGGCGCTCGGG - Intronic
1147168680 17:38605987-38606009 GGGCGGGCGCGCGCGCGGCGCGG + Intergenic
1147967247 17:44199827-44199849 CGGCACACGCGCGCGCGCTCCGG - Intronic
1148271730 17:46266925-46266947 GGCGGCGCGCGCGCGCGGCCGGG - Intergenic
1148284058 17:46372676-46372698 GGGCGCGCGCGCGGGCTCGGCGG - Intergenic
1148284060 17:46372681-46372703 GAGCCCGCGCGCGCGCCCTGTGG + Intergenic
1148306279 17:46590597-46590619 GGGCGCGCGCGCGGGCTCGGCGG - Intergenic
1148306281 17:46590602-46590624 GAGCCCGCGCGCGCGCCCTGTGG + Intergenic
1148826446 17:50397571-50397593 GGGCGTGCCCGCACACGCTCGGG - Intergenic
1151625048 17:75271154-75271176 GGTGGCGCGCGCGCGTGCCCGGG + Exonic
1151854421 17:76710822-76710844 GGGGGCGCGCGGGCAGGCTCCGG + Exonic
1152321580 17:79610947-79610969 GGGCGCGCGAGGCCGGGCTCGGG + Intergenic
1152834251 17:82519462-82519484 TGGCGCGGGCGCGGGAGCTCGGG - Intergenic
1153457515 18:5296220-5296242 GCGCGTGCGCGCGCGTGCGCAGG - Intronic
1154445374 18:14431396-14431418 GGGGACGCGCTCGCACGCTCGGG + Intergenic
1154954285 18:21240558-21240580 GTGCGCGCGCGCGCGCGGGCGGG - Intergenic
1154954287 18:21240562-21240584 GTGTGTGCGCGCGCGCGCGCGGG - Intergenic
1160204518 18:76822323-76822345 GGGCGCGGGCGCGGGCGCGGTGG - Intergenic
1160204582 18:76822520-76822542 GGGCGCGCACGCGCGGGCACCGG - Intergenic
1160680340 19:409215-409237 GGGGGCGCGGGCGCGGGCGCGGG - Intergenic
1160863931 19:1249109-1249131 GGCTGCGCCCGCGCGCGCTCGGG - Intronic
1161051290 19:2165115-2165137 GGGCGCGTGCGTCCGCGCTTGGG + Intronic
1161264905 19:3359631-3359653 GGGACCGAGCGCGCTCGCTCCGG + Intronic
1161572001 19:5035887-5035909 GCGCGCGCGCCTGCGCGCACAGG + Intronic
1161628745 19:5340826-5340848 GGGCGCGCGAGCGGGAGCTAGGG - Intergenic
1161643068 19:5436358-5436380 GTGTGCGCGCGCGCGCGTGCGGG + Intergenic
1161707238 19:5827853-5827875 CGGCGCGCGCGTGCGCGGTTGGG + Exonic
1161802587 19:6424406-6424428 GCGCGCTCGCGCGCGCGCGCAGG - Intronic
1161840620 19:6678117-6678139 GGGCGGTCGCGCGCACGCGCAGG + Intronic
1162485962 19:10960847-10960869 GGACGGGCGCGCACGCGCGCCGG + Intergenic
1163369810 19:16895878-16895900 GCGCGCGCGCGCGCGCATACGGG - Intronic
1163635772 19:18436710-18436732 GGTTGTCCGCGCGCGCGCTCTGG + Exonic
1163681164 19:18683495-18683517 GCGCGCCCAGGCGCGCGCTCGGG - Intergenic
1163708633 19:18832398-18832420 CGGCGCGGGCGCGGGCGCTGCGG + Exonic
1163804126 19:19385918-19385940 GGGTGCGCGTGCGCGCGCCGGGG - Exonic
1163804128 19:19385920-19385942 GGGGGTGCGCGTGCGCGCGCCGG - Exonic
1164658572 19:29942447-29942469 GCGCCCGCGCGCCCGCCCTCAGG - Exonic
1165349489 19:35268421-35268443 GGGCGGGCGCGCGCGAGCCCGGG - Intergenic
1165349924 19:35269726-35269748 GGGCGGGCGGGCGGGCGCGCCGG + Intronic
1166106708 19:40601282-40601304 GGTCGCCCGCGCCCCCGCTCAGG - Intronic
1166304192 19:41928391-41928413 GAGCGCGGGCGGGCGCGCGCCGG + Intronic
1166555831 19:43699452-43699474 AGGCGCGCGCGTGTGCGCTTGGG + Intergenic
1167018949 19:46860562-46860584 GGGCGAGCGCGCGTGCGCGGGGG - Intergenic
1167134408 19:47608631-47608653 GGGCGCGCCTGCTCGAGCTCGGG - Intronic
1167501513 19:49851229-49851251 GGGCGCGGGCGCGCGGCTTCGGG - Exonic
1168076437 19:53982879-53982901 GCGCGCCCGCGCACGCGCCCCGG - Exonic
1168309369 19:55452770-55452792 GGGCGTGCGCGCGCCGGCTGGGG + Intergenic
1168408021 19:56120862-56120884 GGGCGCGCGCGTGCGCGTGGCGG - Intronic
925401421 2:3575766-3575788 GGGTGCTCGGACGCGCGCTCAGG + Intronic
926020182 2:9487834-9487856 GCGCGCGCGCGCGCGCGCTGTGG + Intronic
926020184 2:9487836-9487858 GCGCGCGCGCGCGCGCTGTGGGG + Intronic
926325916 2:11785085-11785107 GGCCTCGCGCGGGCGCCCTCTGG + Intronic
926923576 2:17963770-17963792 GTGCGCGCGCGCGCGCGTCCAGG + Intronic
927904675 2:26848141-26848163 GGCTGCACGCGCGCTCGCTCGGG - Exonic
929313570 2:40452149-40452171 GCGCGCGCGCGCCCGGGCCCCGG - Intronic
929313571 2:40452155-40452177 GGGGGAGCGCGCGCGCGCCCGGG - Intronic
929776644 2:44934626-44934648 AGGCGCGCGCGCGCGCTTGCGGG - Intergenic
930044290 2:47155321-47155343 GGTCCCAGGCGCGCGCGCTCGGG - Exonic
930872694 2:56184420-56184442 GGGAGCGCGGGCGCGCGCGCGGG + Exonic
931649374 2:64454398-64454420 GGGCGCGCGCGCGCGCGCCCGGG - Exonic
931867127 2:66425559-66425581 GCGCGCGCGCGCGCGCGTTCCGG - Intergenic
932625674 2:73293758-73293780 GGGAGCGCGCGCGCACGCAGCGG - Intergenic
932680229 2:73818445-73818467 TGGTGGGCGCGCGCGCGCCCTGG + Intergenic
933206379 2:79512798-79512820 GGCCGCGGGCGCGCGCGGCCTGG - Intronic
935301661 2:101698144-101698166 GGGCCCGCGAGCGGGCGCGCGGG + Intronic
937221744 2:120346066-120346088 GGGCGGGCGCGGGCGCGGGCGGG + Intergenic
941104929 2:161341202-161341224 GGGGGCGCGCGGGCAGGCTCCGG + Intronic
942034728 2:171999843-171999865 GGGAGCGCGCGTGCGCGCGCGGG - Exonic
942314093 2:174682585-174682607 GGGCGCGGGCGCGCGGCCTCGGG - Intronic
943185171 2:184598336-184598358 GGGCGCTCCCACTCGCGCTCGGG + Intergenic
944242616 2:197500324-197500346 GGGCGAGCGCGCCTGCGCGCTGG + Exonic
944675548 2:202032656-202032678 GGGCGCTCGCGCGCGCTCTCTGG - Intergenic
944683637 2:202098818-202098840 GTGCACGCGCGCGCGCGCGCAGG + Intronic
945033357 2:205684937-205684959 GTGTGCGCGCTCGCGCGCTGGGG - Intronic
945203696 2:207310047-207310069 GTGCGCGCGCGCGCGCACGCAGG - Intergenic
945699439 2:213151849-213151871 GCGCGTGTGCGCGCGCGCGCGGG + Intronic
945699440 2:213151853-213151875 GTGTGCGCGCGCGCGCGGGCTGG + Intronic
946362821 2:219229347-219229369 GGGGGCGCGCGCGGGCGCCGGGG - Exonic
947625290 2:231614816-231614838 GTGCGTGCGCGCGCGCGCGCGGG - Intergenic
947792548 2:232876464-232876486 GCGCGCGCAGGCGAGCGCTCAGG + Intronic
948645342 2:239400771-239400793 CGGCGCGCGGGCTCGGGCTCGGG + Exonic
948645378 2:239400877-239400899 GGGTGCGCGGGCTCGGGCTCGGG + Exonic
948910139 2:240998719-240998741 GGGAGCGCGGGCGCGCCCGCTGG - Intergenic
949018177 2:241725294-241725316 GGGCGGGCGCGCGTGAGCTCGGG + Exonic
1169758873 20:9069291-9069313 GTGCGCGCGCGCGCGCGTCCGGG - Intronic
1171982497 20:31637869-31637891 GGGGGCGGGCGCCCGCACTCAGG + Exonic
1172064212 20:32207747-32207769 AGCCGCGCGAGCGGGCGCTCGGG + Exonic
1172489224 20:35321286-35321308 GCGCGCGCGCGCGCACGCTCAGG + Intronic
1173649049 20:44651552-44651574 GTGAGCGCGCGCGGGGGCTCCGG - Intronic
1173807494 20:45935192-45935214 GTGCGCGCGCGCGCGCGCGCTGG + Intronic
1174467865 20:50731430-50731452 GTGCGCGCGCGCGGGCTCGCGGG + Intergenic
1175429606 20:58891952-58891974 GGGCTCGGGAGCGCGCGCCCGGG - Intronic
1175859549 20:62143095-62143117 GGGCGCCCGCGGGCGTGCGCGGG - Intronic
1175859795 20:62143931-62143953 GGGCGGGCGCGCGCGGGGACGGG + Intronic
1175911504 20:62407314-62407336 GGGCGCGCGGGCGCGCGGGCAGG - Intergenic
1175911505 20:62407318-62407340 CGGCGGGCGCGCGGGCGCGCGGG - Intergenic
1176131731 20:63499201-63499223 GGGCGCGGACGCGCGCGGGCGGG + Exonic
1176178537 20:63739520-63739542 GGGCGCGCGGGCGCGCGAGGTGG + Intronic
1176194571 20:63831295-63831317 GGGCGCGCGCGCGCGGGCGGCGG - Intergenic
1176450609 21:6858463-6858485 GGGGACGCGCTCGCACGCTCGGG - Intergenic
1176547221 21:8207219-8207241 GGTTGCGCGCACGCGCGCACCGG + Intergenic
1176547891 21:8209278-8209300 GGGCGCGCGCGCGTGGCCGCCGG + Intergenic
1176548953 21:8213385-8213407 GGGCGCGCGCGCGTACGCGCGGG - Intergenic
1176550494 21:8218947-8218969 GCGCGCGCGCGCGTGCGTGCGGG + Intergenic
1176555126 21:8251428-8251450 GGTTGCGCGCACGCGCGCACCGG + Intergenic
1176556846 21:8257597-8257619 GGGCGCGCGCGCGTACGCGCGGG - Intergenic
1176566172 21:8390266-8390288 GGTTGCGCGCACGCGCGCACCGG + Intergenic
1176566819 21:8392289-8392311 TGGCGCCCGCGGGCGCGCGCAGG - Intergenic
1176567882 21:8396419-8396441 GGGCGGGCGCGCGTACGCGCGGG - Intergenic
1176569424 21:8401986-8402008 GCGCGCGCGCGCGCGCGTGCGGG + Intergenic
1176569426 21:8401988-8402010 GCGCGCGCGCGCGCGTGCGGGGG + Intergenic
1176574046 21:8434452-8434474 GGTTGCGCGCACGCGCGCACCGG + Intergenic
1176575786 21:8440638-8440660 GGGCGGGCGCGCGTACGCGCGGG - Intergenic
1176577336 21:8446217-8446239 GCGCGCGCGCGCGTGCGTGCGGG + Intergenic
1176828779 21:13723481-13723503 GGGGACGCGCTCGCACGCTCGGG - Intergenic
1177077013 21:16588646-16588668 GTGCGCGCGCGTGCTCGCTCGGG + Intergenic
1179225086 21:39445829-39445851 GGGCGCGCGCATGCGCACTCGGG + Intergenic
1179444227 21:41420286-41420308 GGGGGCGCGGGCGCGGGCGCGGG + Intronic
1180101593 21:45590309-45590331 GGGCTCGGCCGCGCGCCCTCCGG - Intergenic
1180215959 21:46324034-46324056 GGTCTCGCGCACGCGCGCTCTGG - Intergenic
1181413296 22:22740185-22740207 GCGCGTGCGCGCGCGCTCTTTGG - Intronic
1181572020 22:23772891-23772913 GGGCGCGCGCGGCCGCGCTGCGG - Exonic
1181574892 22:23787365-23787387 GGGCGCGCGCGCGCGCGCTCGGG + Intronic
1182380397 22:29883121-29883143 GAGGACGCGCGCGCACGCTCGGG - Intergenic
1182435437 22:30326834-30326856 GGCCGCGCGCGCCCGCGGCCGGG - Exonic
1182804455 22:33058385-33058407 GGGGGCGCTCGCGCGCGTTGAGG - Intergenic
1183649451 22:39145663-39145685 GGCCGCGCGCACGCACGCACGGG + Intronic
1183702384 22:39457681-39457703 GGGGGCGGGCGCGGGCGCACTGG + Intronic
1183702386 22:39457683-39457705 GGGCGGGCGCGGGCGCACTGGGG + Intronic
1184680668 22:46070982-46071004 CGGGACGCGCGCGCACGCTCGGG - Intronic
1185351752 22:50343261-50343283 GGGCGCGCACGCTCGCGGCCGGG - Intergenic
1185351766 22:50343302-50343324 CGGCGCACGGGCACGCGCTCCGG - Exonic
1203252094 22_KI270733v1_random:123504-123526 GGTTGCGCGCACGCGCGCACCGG + Intergenic
1203253837 22_KI270733v1_random:129692-129714 GGGCGCGCGCGCGTACGCGCGGG - Intergenic
1203255391 22_KI270733v1_random:135288-135310 GCGCGCGCGCGCGTGCGTGCGGG + Intergenic
1203260148 22_KI270733v1_random:168587-168609 GGTTGCGCGCACGCGCGCACCGG + Intergenic
1203261893 22_KI270733v1_random:174771-174793 GGGCGCGCGCGCGTACGCGCGGG - Intergenic
950438495 3:12994163-12994185 GGGGGCGGGGGCGGGCGCTCGGG + Intronic
950749656 3:15118775-15118797 GGAGCCGCGCGCTCGCGCTCAGG - Intergenic
951558860 3:23946027-23946049 GGGGGCGCGCGCGCGCGCGCTGG + Intronic
951558861 3:23946031-23946053 GCGCGCGCGCGCGCGCTGGCTGG + Intronic
952867067 3:37861655-37861677 GGCCGCGCGCGCGGGGGCCCGGG - Intergenic
953631993 3:44625733-44625755 GTGTGCGCGCGCGCGCGCAAAGG - Intronic
953748699 3:45594042-45594064 CGGCGCGCGGGCGGGCGCCCAGG - Intronic
953925398 3:46980022-46980044 GCGCGCGGGCGCGCGCGCGCAGG + Intronic
954575002 3:51671140-51671162 GGGCGCGTGCGCGCGGGACCCGG - Intronic
954779040 3:53045938-53045960 GGGCGCGAGCGGGCGAGCGCGGG - Exonic
955060246 3:55487212-55487234 GGGCGCGGACGCGCGCGAGCCGG + Exonic
955768570 3:62369078-62369100 GGGAGCCCGGGCGCGCCCTCCGG + Intergenic
956179085 3:66500924-66500946 GCGCGCGCGCGCGCGCTCTCTGG - Exonic
956179087 3:66500933-66500955 GCGCGCGCGCGCGCAGCCTCGGG + Intronic
957792910 3:84961632-84961654 GTGTGTGCGCGCGCGCGCGCCGG + Intronic
958641784 3:96814560-96814582 TTGCGCGCGCGCGCTCTCTCCGG + Intronic
961666020 3:128493414-128493436 AGGGGCGCGCGTGTGCGCTCCGG - Intergenic
963160757 3:142149144-142149166 GGGCGCGGGCCCGCGCGCGGAGG - Intronic
963236670 3:142963356-142963378 GGGCGCGCGCAGGCGACCTCTGG + Exonic
963335713 3:143971974-143971996 GTGCGCGTGCGCGCGGGCACGGG + Exonic
964430471 3:156600518-156600540 GCGCGCGCGCGCGCATGCACTGG + Intergenic
964518859 3:157542597-157542619 GCGCGCGCGCGCGCGCGCGCGGG + Intergenic
966449063 3:180037087-180037109 GGGCACGCGCGCGCGTTCCCAGG + Intergenic
966592230 3:181695790-181695812 ACGCGCGCGCGCGCGTTCTCGGG + Intergenic
966787715 3:183636003-183636025 AGGCGCGCGCGCCCTCCCTCAGG - Intronic
967904164 3:194486977-194486999 GGGGGAGCGCGCGCGGGCTCAGG + Intronic
968178192 3:196569048-196569070 GCGGGCGCGGGCGCGGGCTCGGG + Exonic
968363608 3:198167756-198167778 GGGCGGGATCGCGCGCCCTCTGG - Intergenic
968584072 4:1407844-1407866 GAGCGCGCGGGCGCGTGCACCGG + Intergenic
968879833 4:3293165-3293187 GAGGGCGCGGGCGCGCGCCCCGG - Intronic
969330323 4:6470946-6470968 GCGCGGGCGCGGGCGGGCTCGGG - Intronic
969344738 4:6563674-6563696 GGGCGCGTGAGCGCGGGCCCGGG + Intergenic
970399406 4:15703230-15703252 GGGCGCGCGCGCGGTGGCGCGGG + Exonic
975701981 4:77075641-77075663 GGGGGCGCGGGCGCGGGCGCTGG + Exonic
975778927 4:77819523-77819545 GGGCTCGCGGGCGGGCGCGCAGG + Intronic
976704520 4:88007429-88007451 GGGCGCCCGCGCCCGGGCTCCGG + Intergenic
976897466 4:90128515-90128537 GTGCGCGCGCGCGCGCGCTCTGG + Intronic
977184353 4:93917808-93917830 GCGCGCGCGCGCTCTAGCTCTGG + Intergenic
977574090 4:98658739-98658761 GCGCGCGCGCGCACGGGGTCGGG + Intergenic
977908465 4:102502369-102502391 GCGCGCGCGCGCGCGCACGGAGG - Intronic
977937854 4:102827161-102827183 GGGCGCGCGCGGGAGCGCGCTGG - Intronic
978754261 4:112285827-112285849 GGCCGCGCGCGCGGGAGCGCGGG - Exonic
979205544 4:118033557-118033579 CGGCCCGCGCGCGCCCGCCCCGG - Intergenic
981093414 4:140756124-140756146 GGGCGGGCGCGCGTGTGCCCAGG - Intergenic
981604016 4:146522819-146522841 GGGCGCGCGGGTGCCCGCTCTGG + Intergenic
984024118 4:174522522-174522544 GGCTGCACGCGCGCGCGCGCAGG - Exonic
984167447 4:176319908-176319930 GGGCGCGCGCGCGCTCGCGTCGG + Intergenic
984966383 4:185143600-185143622 GGGCGGGCGGGCGGGCGCCCGGG - Intronic
986748027 5:10761123-10761145 GGGCGTGCGCGAGTGAGCTCAGG + Exonic
986976028 5:13395018-13395040 GTGTGCACGCGCGCGCGCACTGG - Intergenic
986976034 5:13395105-13395127 GTGTGCGCGCGCGCGTGCACTGG - Intergenic
986976046 5:13395291-13395313 GCGCGCGCGCACGCGCGCACTGG - Intergenic
987303420 5:16617006-16617028 GCGCGCGCGCGGGCGCGCCTGGG + Exonic
987901086 5:24013048-24013070 GTGCGCGCGCGCGCAGGCTGTGG + Intronic
989178907 5:38556769-38556791 GCGCGCGCGGGCGCGCGGCCGGG - Intronic
989178910 5:38556772-38556794 GGCCGCGCGCCCGCGCGCGCGGG + Intronic
992105536 5:73447280-73447302 GGGCGAGCGCGCCAGCGCTGAGG + Exonic
992286112 5:75236993-75237015 GAGGCCGCGCGCGCGCGCGCAGG + Intergenic
992487598 5:77210889-77210911 GGGCGCGGGCGGGCGCGCGGGGG + Exonic
993919146 5:93779125-93779147 GCGCGCGCGCGCGCACGTGCAGG + Intronic
997237158 5:132279342-132279364 GTGCGCGCGCGCGCGCGCGTGGG - Intronic
997582966 5:135028714-135028736 GGGCGCGGGCGCGGGCGCGGAGG - Exonic
997980535 5:138465279-138465301 GGGCGCGGGCGCGGGCCCTAGGG + Intergenic
998131267 5:139652145-139652167 GCGCGCGCGCGCGCGCGCGCCGG - Intronic
998583232 5:143402759-143402781 GGGCTCGCGCTCGGGCGCGCCGG + Intronic
999129444 5:149271793-149271815 GGGCGGGCGCGGGCGCGGGCGGG + Intergenic
999239131 5:150117521-150117543 GCGCGCGCGCGCGCGCTGCCAGG - Intronic
1000071407 5:157743963-157743985 GCGCGGGCGCGGGCGGGCTCGGG + Exonic
1001906576 5:175478515-175478537 GCGCGCGCGAGGACGCGCTCCGG + Exonic
1002204698 5:177554401-177554423 GGGCAGGCGCGAGCGGGCTCGGG - Exonic
1002515250 5:179753223-179753245 GCGCGCGCGCGCGCGCGTGCTGG + Intronic
1002515252 5:179753225-179753247 GCGCGCGCGCGCGCGTGCTGGGG + Intronic
1002521759 5:179796267-179796289 ACGCGAGCGCGCGCGCCCTCTGG + Exonic
1002559739 5:180072914-180072936 GTGTGCGCGCGCGCGCGTTTCGG - Intergenic
1003098988 6:3162969-3162991 GGTCGCGCGCCCCGGCGCTCCGG - Intergenic
1003942603 6:11044121-11044143 GGGCGCCGGCGCGGGCGCTGCGG - Intronic
1004069728 6:12287754-12287776 AGGCGCGCGCGCGCGCGCGCAGG + Intergenic
1004216918 6:13711722-13711744 CGGGCCGCGCGCCCGCGCTCCGG - Intergenic
1004720445 6:18264216-18264238 GGGCGGGCGCGCGCGCACGCGGG - Intronic
1004767717 6:18749550-18749572 GCGCGCGCGCACGCGCGCGCAGG - Intergenic
1004924328 6:20403284-20403306 GGGCTCGCGGGCTGGCGCTCTGG + Intronic
1005871425 6:29976715-29976737 GGGCGCCCGAGCGCGTTCTCAGG + Intergenic
1006125373 6:31834555-31834577 GCGCGCGCCCGCGCGCGCGCGGG + Intergenic
1006271987 6:32972082-32972104 GAGCGAGCGCGCGCGCGCGGAGG + Exonic
1007137900 6:39540609-39540631 GGGCGAGCACGCGCCTGCTCGGG + Intronic
1007451313 6:41941776-41941798 CGGCGCGCGCGCGCGGGCGGCGG - Exonic
1011112438 6:83853489-83853511 CGGCGCGCGGGCGCGGACTCCGG + Exonic
1011277200 6:85642968-85642990 GCGGGGGCGCGCGCGCGCACCGG - Exonic
1011640469 6:89412323-89412345 GAGCGCGCGCGCGCCCGTGCGGG - Intergenic
1012872897 6:104693053-104693075 GTGTGCACGCGCGCGCGCGCTGG + Intergenic
1012872899 6:104693055-104693077 GTGCACGCGCGCGCGCGCTGGGG + Intergenic
1012886513 6:104852227-104852249 GTGCGCGCGTGCGCGTGCACGGG + Intronic
1013576054 6:111483844-111483866 GGGCGCGCGGGCGCGGGCTTCGG + Intergenic
1014137629 6:117907505-117907527 GGGCGCGAGGGTGCGCGCACTGG + Exonic
1014632355 6:123803245-123803267 GTGTGTGTGCGCGCGCGCTCGGG - Intergenic
1014798206 6:125749286-125749308 GGGCGCGCGGGGGCGGGCCCTGG - Intronic
1015626036 6:135181568-135181590 GGGGGCGCGCGGGGGCGCGCGGG + Intronic
1017163830 6:151390435-151390457 GCGAGCGCGCGCGCGCACGCGGG - Intronic
1017913944 6:158818370-158818392 GGGCGCGCGCCCCCGCTCTCGGG - Intronic
1018329956 6:162716755-162716777 GTGTGCGTGCGCGCGCGCGCAGG - Intronic
1019252093 7:20927-20949 GGGCGGGATCGCGCGCCCTCTGG + Intergenic
1020125230 7:5529743-5529765 GGGCGCGCGCCGGCGCCCCCTGG - Intronic
1020253004 7:6484192-6484214 TGCCCCGCGCGCGCGCGCGCCGG - Exonic
1021107625 7:16656540-16656562 GTGTGTGCGCGCGCGCGCTGGGG - Intronic
1022101203 7:27170030-27170052 GGGCGCAGGAGCGCGCGCCCCGG - Intronic
1022230748 7:28410062-28410084 GGGCGGGTGGGCGCGCGCGCAGG + Intronic
1022427908 7:30285394-30285416 GGCCGCACGCGCGCGTACTCGGG + Exonic
1022715190 7:32892001-32892023 AGGCGCGCGCGCGCGCGAGGCGG - Intronic
1023447680 7:40248869-40248891 GTGCGAGCGCGCGCGCGCGCTGG - Intronic
1023945122 7:44796898-44796920 GGGCGAGCGCGGGCGGGCTGCGG + Intronic
1023972157 7:44999803-44999825 GCGCGCGCGGGAGCGCGCGCGGG - Intronic
1025198615 7:56949171-56949193 GGGCGCGGGCGCGCAGGGTCAGG - Intergenic
1025673337 7:63627765-63627787 GGGCGCGGGCGCGCAGGGTCAGG + Intergenic
1026000350 7:66556272-66556294 GGGCGCGGGCGCGGGCGCGAGGG - Intergenic
1027539919 7:79453725-79453747 GGGAACGCGCGCGCGCGCCTGGG + Intergenic
1027592553 7:80134746-80134768 ACGTGCGCGGGCGCGCGCTCTGG + Intronic
1027654967 7:80919206-80919228 AGGCTCTCGCGGGCGCGCTCGGG - Exonic
1031213281 7:118858667-118858689 GAGCGCGCGCGCGCGCGCGTGGG - Intergenic
1031886596 7:127251690-127251712 GGGCGTGGGCGCGGGCGCTCGGG - Intronic
1033300015 7:140177043-140177065 GGCCTCGCGCGCGCGCACTGAGG - Intergenic
1033339338 7:140479524-140479546 GGCCGCGGGCGCGCATGCTCTGG - Exonic
1033927025 7:146474982-146475004 GCGCGTGCGCGCTCGTGCTCAGG - Intronic
1034475111 7:151277098-151277120 GGGAGCGGGCGGCCGCGCTCCGG - Intronic
1036578821 8:10054386-10054408 GGGCGCGGGCGGGCGGGCGCGGG - Exonic
1036930600 8:12951950-12951972 GGGAGCGCGCGCGCGGGCCGGGG - Intronic
1036930602 8:12951952-12951974 GGGGGAGCGCGCGCGCGGGCCGG - Intronic
1037811470 8:22089391-22089413 GGGCGGGCGCGGGCCCCCTCGGG + Intronic
1037878411 8:22560871-22560893 GTGCGCGCGCGCACGCGCCGTGG + Intronic
1037900476 8:22685425-22685447 GCGCGCGCGCGCGCGCGCGCGGG + Intergenic
1037900478 8:22685429-22685451 GCGCGCGCGCGCGCGCGGGGAGG + Intergenic
1038767909 8:30446841-30446863 GTGCGCGCGCGCGCGCGCGGTGG + Intronic
1039903126 8:41767182-41767204 GGGTGCGGGTGCGCGCGCTGGGG - Intronic
1041689883 8:60678640-60678662 CGGCGCGCGGGCGCGGGCGCGGG + Intergenic
1044115311 8:88327743-88327765 GCGCGCGCGCGCGCGCGCCAAGG - Intronic
1044719692 8:95133760-95133782 GGGCGCGCCCGTGCGCGCGCAGG + Intergenic
1047961750 8:130016316-130016338 GGGCGCGCGCGCGGGCCGGCCGG + Intronic
1049109760 8:140635538-140635560 GGGCGGCCGCGCGCGCGCCACGG + Exonic
1049719263 8:144108123-144108145 GGGCGCGGGCGCGCGGGGTCAGG - Exonic
1050437853 9:5628956-5628978 GAGGGCCCGCGCGCGCGCTCTGG - Intergenic
1050552130 9:6757949-6757971 CGGCGCGCGCGCCCTCGCGCAGG + Intronic
1053435129 9:38069178-38069200 GGGCACGGGCGCGCGGGCTCCGG - Exonic
1053435168 9:38069303-38069325 CGGGGCGCGCGAGCGGGCTCCGG - Intergenic
1054842662 9:69760012-69760034 GAGCGCGCGCGCGCGCGCGCGGG + Intergenic
1054842663 9:69760020-69760042 GCGCGCGCGCGCGGGTGCTTCGG + Intergenic
1055158921 9:73100353-73100375 GCGCGCGCGCGCGCGTGCATAGG + Intergenic
1055397632 9:75891512-75891534 GTGCGTACGCGCGCGCGCGCAGG - Intronic
1057489561 9:95510846-95510868 AGCCGGGCGCGCGCGCGCACCGG - Intronic
1057619104 9:96619418-96619440 CGGCGGGCGCGCGGGCGCGCGGG - Exonic
1057708023 9:97411999-97412021 CTGCGCACGCGCGGGCGCTCCGG - Exonic
1058602538 9:106685482-106685504 ACGCGCGCGCGCGCGCGCACAGG - Intergenic
1059270464 9:113067530-113067552 GTGTGCGCGCGCGCGCGTGCTGG + Intergenic
1059270466 9:113067532-113067554 GTGCGCGCGCGCGCGTGCTGGGG + Intergenic
1059271601 9:113072980-113073002 GTGTGCGCGCGCGCGCGTGCTGG + Intergenic
1059271603 9:113072982-113073004 GTGCGCGCGCGCGCGTGCTGGGG + Intergenic
1059272732 9:113078424-113078446 GTGTGCGCGCGCGCGCGTGCTGG + Intergenic
1059272734 9:113078426-113078448 GTGCGCGCGCGCGCGTGCTGGGG + Intergenic
1059273866 9:113083866-113083888 GTGTGCGCGCGCGCGCGTGCTGG + Intergenic
1059273868 9:113083868-113083890 GTGCGCGCGCGCGCGTGCTGGGG + Intergenic
1059274999 9:113089310-113089332 GTGTGCGCGCGCGCGCGTGCTGG + Intergenic
1059275001 9:113089312-113089334 GTGCGCGCGCGCGCGTGCTGGGG + Intergenic
1060128687 9:121074927-121074949 GGGGCCGCGCGCGCGTGGTCGGG - Intronic
1060283377 9:122228494-122228516 GGGAGCGCGCGCGCGAGCGGGGG - Intronic
1060514576 9:124257917-124257939 GGGCGGGCGCGCGGGCGCGCGGG + Intronic
1061134308 9:128724359-128724381 GGGGAGGTGCGCGCGCGCTCCGG - Intergenic
1062341433 9:136095379-136095401 GGCCGCGCGCGCGCGCGCACTGG + Intergenic
1062653590 9:137590627-137590649 GGGCGAGTGCGCCGGCGCTCTGG + Intergenic
1062748248 9:138230988-138231010 GGGCGGGATCGCGCGCCCTCTGG - Intergenic
1203518573 Un_GL000213v1:26054-26076 GGGGACGCGCTCGCACGCTCGGG + Intergenic
1203468497 Un_GL000220v1:106654-106676 GGTTGCGCGCACGCGCGCACCGG + Intergenic
1203470237 Un_GL000220v1:112840-112862 GGGCGGGCGCGCGTACGCGCGGG - Intergenic
1203471789 Un_GL000220v1:118423-118445 GCGCGCGCGCGCGCGCGTGCGGG + Intergenic
1203471791 Un_GL000220v1:118425-118447 GCGCGCGCGCGCGCGTGCGGGGG + Intergenic
1203476318 Un_GL000220v1:150626-150648 GGTTGCGCGCACGCGCGCACCGG + Intergenic
1203478058 Un_GL000220v1:156812-156834 GGGCGGGCGCGCGTACGCGCGGG - Intergenic
1185504799 X:624229-624251 GGGCTGGCGCGCGCGCGCGAGGG + Intergenic
1185610574 X:1391872-1391894 GGACGCGGGCGCGGCCGCTCCGG - Intronic
1186669904 X:11758055-11758077 TGGCGCGCGCGCTCCCGCCCGGG - Intergenic
1187067551 X:15855069-15855091 GCGCGGGCGCGCGGGCGCTCGGG - Intergenic
1187265002 X:17723769-17723791 GTGCGCGCGCGTGCGCGCATGGG + Intronic
1187341462 X:18425339-18425361 CGGCGCGCGCGTGAGCGCGCAGG + Intergenic
1187675770 X:21715310-21715332 ACGCGCGCGCGCTCGCGCGCTGG + Intronic
1188597812 X:31922522-31922544 GTGTGCGCGCGCGTGCGCTAGGG + Intronic
1189004968 X:36985774-36985796 GGACGCGTGCGCCCGCGCTGAGG - Intergenic
1195316845 X:103687501-103687523 GGGCGCGCGCGCGTGCGTGATGG + Intronic
1196180110 X:112680193-112680215 GAGCGCGCGCGCATGCGCGCAGG + Intergenic
1198808472 X:140511037-140511059 GGGAAAGCGCGCGCGCGCTGGGG - Intergenic
1199760116 X:150898700-150898722 CCGCGCGCGCGCGCGGGCTTTGG - Exonic
1200233540 X:154457985-154458007 GCGCGGGCGCGCGCGGGTTCCGG + Intergenic