ID: 1181575223

View in Genome Browser
Species Human (GRCh38)
Location 22:23789899-23789921
Sequence ACAGCTCCACAGATGGCGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 135}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181575223 Original CRISPR ACAGCTCCACAGATGGCGCA TGG (reversed) Intronic
900389039 1:2426171-2426193 ACATCTGCACAGATGGTGAAAGG - Intronic
902375208 1:16027206-16027228 ACAGCAGGACAGATGGCTCAGGG + Intronic
902536623 1:17122586-17122608 ACAGCTCCTGGCATGGCGCAAGG - Intergenic
904265052 1:29313342-29313364 TCAGCTCCCCAAATGCCGCATGG + Intronic
905370670 1:37481122-37481144 GCAGCTCCCCAGGTGGGGCATGG + Intronic
905915592 1:41682266-41682288 GCACCTCCACAGGTGGCTCAGGG + Intronic
906296634 1:44652736-44652758 ACAGCTCCAGCGATGGCTGAGGG + Intronic
912639655 1:111332933-111332955 ACAGCTCCACAGGTGGCACCTGG - Intergenic
915095615 1:153460244-153460266 CCAGCTCCACAGAGGGTGGAGGG - Intronic
915203431 1:154251211-154251233 TCGGCTCCACAGATGTCGCCTGG + Exonic
917118056 1:171622289-171622311 AAATCTCCACAGATGTCGCAGGG - Intergenic
917483187 1:175431075-175431097 ACGGCTCCACACAGGGCCCAGGG + Intronic
919921357 1:202168329-202168351 ACAGCCCCACACATGGCCAAGGG - Intergenic
920916191 1:210259932-210259954 GGAGCTCCAGAGATGGGGCAGGG + Intergenic
923715728 1:236423385-236423407 ACTGCCCCACACATAGCGCAAGG - Intronic
1064433419 10:15290534-15290556 ACACCCCCACAGTTGGCCCAAGG - Intronic
1066708117 10:38203169-38203191 ACAGGTCCACAGCTGGGACATGG - Intergenic
1067372665 10:45699712-45699734 CCAGCTCCAGAGATCGCACACGG - Intergenic
1067387113 10:45826412-45826434 CCAGCTCCAGAGATCGCACACGG + Exonic
1067419014 10:46130839-46130861 CCAGCTCCAGAGATCGCACACGG - Intergenic
1067447159 10:46358195-46358217 CCAGCTCCAGAGATCGCACACGG - Intergenic
1067504367 10:46837428-46837450 CCAGCTCCAGAGATCGCACACGG - Intergenic
1067590219 10:47502565-47502587 CCAGCTCCAGAGATCGCACACGG + Exonic
1067637339 10:48010667-48010689 CCAGCTCCAGAGATCGCACACGG + Intergenic
1067876150 10:50009667-50009689 CCAGCTCCAGAGATCGCACACGG - Exonic
1067944067 10:50679489-50679511 ACACCTCCACAGAGGGCGCCTGG - Intergenic
1070133937 10:73675096-73675118 CCAGCTCCAGAGATCGCACACGG + Exonic
1070865561 10:79706359-79706381 ACACCTCCGCAGAGGGCGCCTGG - Exonic
1070879354 10:79844490-79844512 ACACCTCCGCAGAGGGCGCCTGG - Exonic
1071607778 10:87009386-87009408 CCAGCTCCAGAGATCGCACACGG - Intergenic
1071632462 10:87228580-87228602 ACACCTCCGCAGAGGGCGCCTGG - Exonic
1071645911 10:87360798-87360820 ACACCTCCGCAGAGGGCGCCTGG - Exonic
1075073700 10:119336257-119336279 ACGGCTCCACAGTTTGCCCAGGG + Intronic
1077551695 11:3203343-3203365 CCCCCTCCACAGATGGCGCGAGG + Intergenic
1083063714 11:59901009-59901031 ACAGCTCCAGGGATGGGGCGGGG - Intergenic
1083793991 11:65003974-65003996 ACAGGTCCAGAGAGGGCACAAGG - Intergenic
1084164867 11:67370914-67370936 AGAGCTCCAGAGGTGGGGCATGG + Intronic
1084480034 11:69414853-69414875 ACAGCTCCACAGGCGTCCCAGGG - Intergenic
1088371176 11:109090013-109090035 ATAGCTCCAGAGATGGTGCCAGG + Intergenic
1089296517 11:117472180-117472202 ACAACTTCACAGACGGTGCAAGG + Intronic
1095829500 12:46569426-46569448 ACAGCTCCACAGATTTCCCATGG - Intergenic
1101092908 12:101305924-101305946 ACAGCAACACAGATGGCTCCAGG - Exonic
1101284072 12:103291486-103291508 ACTGCTCCACAGACAGAGCAGGG + Intronic
1104067537 12:125317767-125317789 AGAGCTCCCCAGATGAAGCAAGG - Intronic
1104483325 12:129127925-129127947 ACAGCTGCACAGAAGCCTCAGGG - Intronic
1108407043 13:50114938-50114960 AGAGCTCCACAGAGGGATCAGGG - Intronic
1108615834 13:52131133-52131155 ACAGCTAAGCAGATGGCGGATGG + Intergenic
1111861636 13:93714730-93714752 GCTTCTCCACAGATGGAGCAAGG + Intronic
1111959155 13:94790670-94790692 GCAGATCCACAGATGGCATAAGG + Intergenic
1112491870 13:99873078-99873100 AAACCTCCACAAATGGGGCAGGG - Intronic
1113232342 13:108226718-108226740 ACATCTCAGCAGATGGTGCATGG + Intronic
1113605704 13:111603677-111603699 AGAGCTCCTCAGATGCCGCCAGG - Intronic
1113999662 14:16401860-16401882 TCAGCTCCTCAGACGGCGGAAGG - Intergenic
1114458416 14:22872086-22872108 ACAACTCCAAAGTTGGCGAAAGG + Exonic
1120939370 14:89932224-89932246 ACACCTCCATAGGTGGCTCATGG + Intronic
1121779713 14:96614496-96614518 ACTGATCCACAGATGACGGATGG + Intergenic
1131072282 15:89473374-89473396 CCAGGACCACAGATGGGGCAAGG - Intronic
1132759505 16:1501915-1501937 CCAGCTCCACCGTAGGCGCAGGG + Intronic
1136170028 16:28483534-28483556 ACAGCTCCACAGATGGCCATTGG + Intronic
1138460612 16:57145626-57145648 ACAGGCCCACGGCTGGCGCAGGG - Intronic
1138557715 16:57782284-57782306 ACAGCTGCCCAGCTGGCACATGG + Intronic
1139327606 16:66164314-66164336 ACAGCTCCTCAAATGGGGCAGGG + Intergenic
1141207153 16:81941423-81941445 GCAGCTCCCCAGATGGTGCTTGG + Intronic
1141323487 16:83034326-83034348 ACAGCTTCACAGATGCTGAAGGG - Intronic
1142680140 17:1542675-1542697 ACAGATGCACAGATGGGGAAGGG + Intronic
1144885044 17:18452069-18452091 ACACCTGCCTAGATGGCGCATGG + Intergenic
1146567862 17:33928767-33928789 GCAGATCCACAGATGGAGGAGGG + Intronic
1146686780 17:34846429-34846451 GCAGCTTCCCAGATGGCCCAGGG + Intergenic
1150808404 17:68337142-68337164 ACTGCTCCCCAGATGGCAGATGG + Intronic
1151661095 17:75518592-75518614 ACACCTCCACAGATGCCGGTGGG - Intronic
1160716593 19:579566-579588 ACAGCGCCACAGAGGTCACAGGG + Exonic
1164974747 19:32563971-32563993 CCAGCTCCACAGCCGACGCATGG + Intergenic
927422585 2:22948749-22948771 ACAGGTCCACAGATGGAATAAGG + Intergenic
928362684 2:30678535-30678557 ACAGCTCCACAGCTGGCTTTGGG + Intergenic
931231726 2:60380821-60380843 ACAGCCCCACAGATGGAGCTGGG - Intergenic
934620642 2:95802121-95802143 ACAGCTCCACCCATGGAGAATGG - Intergenic
934812795 2:97297602-97297624 ACAGCTCCACCCATGGAGAATGG + Intergenic
934824900 2:97410870-97410892 ACAGCTCCACCCATGGAGAATGG - Intergenic
1168786504 20:544142-544164 ACAGCTCTGCAGGTCGCGCATGG - Intergenic
1171727081 20:28634010-28634032 TCAGCTCCTCAGACGGCGGAAGG - Intergenic
1171751177 20:29050608-29050630 TCAGCTCCCCAGACGGCGGAAGG + Intergenic
1171791803 20:29533324-29533346 TCAGCTCCTCAGACGGCGGAAGG - Intergenic
1171856542 20:30349559-30349581 TCAGCTCCTCAGATGACGGAAGG + Intergenic
1172089160 20:32415359-32415381 ACAGCTCAAGGGATGGGGCATGG - Intronic
1173811262 20:45957308-45957330 ACAGGGCCCCAGATGCCGCAGGG + Intronic
1175093420 20:56523117-56523139 ATAGCTCTACAGATGACCCAGGG + Intronic
1175094528 20:56530959-56530981 ATAGCTCTACAGATGACCCAGGG + Intergenic
1175970154 20:62682192-62682214 ACAGCTCTTCAGATGGAGAAGGG + Intronic
1176313600 21:5220322-5220344 TCAGCTCCTCAGACGGCGGAAGG - Intergenic
1179469188 21:41599181-41599203 ACAGATCCCCAGATGGGGAAAGG + Intergenic
1179951173 21:44709529-44709551 ACAACTCCAGAGAAGGCGCATGG + Intronic
1180221673 21:46363073-46363095 CCAGCCCCACAGATAGCGCTGGG - Intronic
1180391423 22:12286428-12286450 TCAGCTCCTCAGACGGCGGAAGG - Intergenic
1180408321 22:12578326-12578348 TCAGCTCCTCAGACGGCGGAAGG + Intergenic
1180612432 22:17106663-17106685 ACAGCTTCCCAGATGACGGAAGG - Intronic
1181402820 22:22661616-22661638 ACAGCAGCACAGATGGGGAAGGG - Intergenic
1181575223 22:23789899-23789921 ACAGCTCCACAGATGGCGCATGG - Intronic
1181587129 22:23859173-23859195 ACAGCTCCACGGGGGCCGCATGG - Intronic
1182397542 22:30047076-30047098 AGAGCTCCACAGCTGGATCAAGG - Intergenic
1183436007 22:37795662-37795684 ACAGAAACAAAGATGGCGCATGG - Intergenic
949602389 3:5614195-5614217 ACTGTTCCACAGATAGAGCAGGG - Intergenic
949866292 3:8550171-8550193 ACTGCCCCACAGAAGGCGAAAGG + Intronic
953250479 3:41242151-41242173 AAATATCCACAGATGGAGCAAGG + Intronic
953506928 3:43495573-43495595 GCAGCTTCACAGATGAGGCATGG + Intronic
960696984 3:120405976-120405998 ATGGCTCCCCAGATGGTGCAAGG + Intronic
961005791 3:123404541-123404563 ACAGCTGGAAAGATGGGGCAAGG - Intronic
963358219 3:144237374-144237396 ACAACTCCACGGATGCCACATGG - Intergenic
963741475 3:149086205-149086227 ACAGCTGCACAAATCGCCCAGGG + Intronic
969560125 4:7941468-7941490 ACAGCACCCCAGCTGGCGCTGGG - Intergenic
969617487 4:8262176-8262198 AGAGACCCACAGATGGGGCAGGG + Intergenic
969809260 4:9635219-9635241 GCAGCCCCACAGATGGAGTAGGG - Intergenic
981981308 4:150794260-150794282 CCAGCTCCATACATGGCACAAGG - Intronic
984294134 4:177832107-177832129 ACAGGTCCACAGAAGGTGGACGG - Intronic
986249421 5:6043147-6043169 ACAGCTCCTCAGATGAGGCTGGG - Intergenic
1000825476 5:166038687-166038709 GCAGTTCCAGAGATGGTGCAAGG + Intergenic
1003198818 6:3939868-3939890 TCAGCTCCACAGATGGAGCCTGG - Intergenic
1003573934 6:7275796-7275818 GCAGCTCTACAGATGACCCACGG + Intronic
1013419282 6:109951369-109951391 ACAGCTTCAGAGATGAGGCAAGG + Intergenic
1015768830 6:136748098-136748120 ACAGCTCTACAGATGACTCAAGG - Intronic
1016323751 6:142876556-142876578 ACAGCTCCAAAGAATGCACAAGG + Intronic
1016992675 6:149940896-149940918 CCAGGTCCACGGATGGCACAGGG - Intergenic
1017005658 6:150026659-150026681 CCAGGTCCACCGATGGCACAGGG + Intergenic
1018042268 6:159935381-159935403 ACAGGTCCAGAGATGGTGAACGG - Intergenic
1018862690 6:167722651-167722673 ACGGCTCCACAGAAGCCGCCAGG + Intergenic
1023165664 7:37341160-37341182 AAAGCTCCACAGATTGAGAAGGG + Intronic
1024004424 7:45215108-45215130 ACAGCTCCAGAGGTGGCACTGGG - Intergenic
1032513391 7:132489746-132489768 AAAGCTCCCAAGATGGCGCTGGG - Intronic
1033513935 7:142087553-142087575 ACAGCTCCAGAGGTAGGGCAAGG - Intronic
1034136767 7:148778174-148778196 ACAGTTCTTCAGATGGAGCATGG - Intronic
1038238849 8:25788768-25788790 ACAGCTCCAGAGAAGACTCATGG + Intergenic
1038671063 8:29583436-29583458 ACTTCTCCACAAATGGCCCAGGG - Intergenic
1039695211 8:39903225-39903247 TCATTACCACAGATGGCGCAGGG - Intronic
1045534030 8:103010317-103010339 ATAGCTCCTCAGGTGGCTCAGGG + Intergenic
1048294742 8:133206052-133206074 ACAGCACCACAGGTGCGGCATGG + Intronic
1049600514 8:143505336-143505358 GCAGCACCGGAGATGGCGCATGG + Intronic
1055638317 9:78298524-78298546 ACATCTCCACAGCTGGAGCAGGG - Intronic
1057023982 9:91722179-91722201 ACTGCACCACAGATAGAGCAGGG + Intronic
1057355058 9:94325595-94325617 ACACCTCCACAGAGGGTGCCTGG + Exonic
1057576378 9:96245829-96245851 ACAGCTGGACAGATGTCACATGG + Intronic
1057652693 9:96932039-96932061 ACACCTCCACAGAGGGTGCCTGG - Exonic
1060698116 9:125727334-125727356 ACAGATTCACAAAGGGCGCAGGG - Intergenic
1061945354 9:133905644-133905666 TCAGCTCCCCAGATGTCACAGGG - Intronic
1062371574 9:136241880-136241902 CCAGGGCCACAGAGGGCGCACGG + Intronic
1062685074 9:137808325-137808347 AGAGCTCCAACCATGGCGCAGGG - Intronic
1203452507 Un_GL000219v1:132889-132911 TCAGCTCCTCAGACGGCGGAAGG - Intergenic
1189327183 X:40120030-40120052 ACTGCTCCACAGTTGGGGCGGGG + Intronic
1198298073 X:135306243-135306265 ACAGATCCACAGATGGCTTCAGG + Intronic