ID: 1181575981

View in Genome Browser
Species Human (GRCh38)
Location 22:23795213-23795235
Sequence ACGATTTGACTGTGTTGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 11559
Summary {0: 1, 1: 0, 2: 38, 3: 995, 4: 10525}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181575975_1181575981 28 Left 1181575975 22:23795162-23795184 CCTGTAATCTCAGCACTTTGGGA 0: 16720
1: 305812
2: 257224
3: 144363
4: 132215
Right 1181575981 22:23795213-23795235 ACGATTTGACTGTGTTGCCCAGG 0: 1
1: 0
2: 38
3: 995
4: 10525

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181575981 Original CRISPR ACGATTTGACTGTGTTGCCC AGG Intronic
Too many off-targets to display for this crispr