ID: 1181577373

View in Genome Browser
Species Human (GRCh38)
Location 22:23803499-23803521
Sequence GCTGCCTGTCAGGCAGATTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 213}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181577368_1181577373 -9 Left 1181577368 22:23803485-23803507 CCCGTTTCCTGCCAGCTGCCTGT 0: 1
1: 1
2: 1
3: 35
4: 418
Right 1181577373 22:23803499-23803521 GCTGCCTGTCAGGCAGATTCTGG 0: 1
1: 0
2: 1
3: 11
4: 213
1181577359_1181577373 27 Left 1181577359 22:23803449-23803471 CCTGGCCCCAACCCCTGTGTGTT 0: 1
1: 0
2: 4
3: 35
4: 341
Right 1181577373 22:23803499-23803521 GCTGCCTGTCAGGCAGATTCTGG 0: 1
1: 0
2: 1
3: 11
4: 213
1181577369_1181577373 -10 Left 1181577369 22:23803486-23803508 CCGTTTCCTGCCAGCTGCCTGTC 0: 1
1: 0
2: 5
3: 48
4: 540
Right 1181577373 22:23803499-23803521 GCTGCCTGTCAGGCAGATTCTGG 0: 1
1: 0
2: 1
3: 11
4: 213
1181577363_1181577373 20 Left 1181577363 22:23803456-23803478 CCAACCCCTGTGTGTTACGTGGG 0: 1
1: 0
2: 1
3: 5
4: 73
Right 1181577373 22:23803499-23803521 GCTGCCTGTCAGGCAGATTCTGG 0: 1
1: 0
2: 1
3: 11
4: 213
1181577361_1181577373 21 Left 1181577361 22:23803455-23803477 CCCAACCCCTGTGTGTTACGTGG 0: 1
1: 0
2: 0
3: 6
4: 80
Right 1181577373 22:23803499-23803521 GCTGCCTGTCAGGCAGATTCTGG 0: 1
1: 0
2: 1
3: 11
4: 213
1181577360_1181577373 22 Left 1181577360 22:23803454-23803476 CCCCAACCCCTGTGTGTTACGTG 0: 1
1: 0
2: 0
3: 3
4: 103
Right 1181577373 22:23803499-23803521 GCTGCCTGTCAGGCAGATTCTGG 0: 1
1: 0
2: 1
3: 11
4: 213
1181577367_1181577373 14 Left 1181577367 22:23803462-23803484 CCTGTGTGTTACGTGGGAACAGT 0: 1
1: 0
2: 0
3: 4
4: 64
Right 1181577373 22:23803499-23803521 GCTGCCTGTCAGGCAGATTCTGG 0: 1
1: 0
2: 1
3: 11
4: 213
1181577365_1181577373 16 Left 1181577365 22:23803460-23803482 CCCCTGTGTGTTACGTGGGAACA 0: 1
1: 0
2: 0
3: 6
4: 77
Right 1181577373 22:23803499-23803521 GCTGCCTGTCAGGCAGATTCTGG 0: 1
1: 0
2: 1
3: 11
4: 213
1181577366_1181577373 15 Left 1181577366 22:23803461-23803483 CCCTGTGTGTTACGTGGGAACAG 0: 1
1: 0
2: 0
3: 6
4: 102
Right 1181577373 22:23803499-23803521 GCTGCCTGTCAGGCAGATTCTGG 0: 1
1: 0
2: 1
3: 11
4: 213

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181577373 Original CRISPR GCTGCCTGTCAGGCAGATTC TGG Intronic
900353469 1:2248266-2248288 GCTGCCAGCCAGGCTGAGTCCGG - Intronic
900791726 1:4685110-4685132 GCTGGCTGTCACACAGATGCTGG - Intronic
901640242 1:10689380-10689402 GCTGCAGCTCAGCCAGATTCTGG + Intronic
901658936 1:10786816-10786838 GCTGCCTTTCAGGCAGAATGGGG - Intronic
906160448 1:43644913-43644935 ACTGGCAGGCAGGCAGATTCTGG + Intergenic
906495663 1:46302626-46302648 GTGGCGTGTCAGGCAGATGCTGG + Intronic
906616334 1:47235321-47235343 GCTGCCTGACTGTCAGAATCTGG - Intergenic
906943459 1:50275793-50275815 GCTGCTTGTCAGGCTGGTGCTGG - Intergenic
907089276 1:51709474-51709496 GTTGGCTGCCAGGCAGGTTCTGG - Intronic
907386576 1:54129439-54129461 GCTGCAGGTCAGGCAGACTTGGG - Intergenic
907424402 1:54370186-54370208 GCTGGCTGTCAAGCAGGTACAGG + Intronic
910371742 1:86523867-86523889 GGTGCCTGTCAGGGAGTCTCAGG + Intergenic
913141286 1:115943686-115943708 GCTTCCTGTCAGTGAAATTCAGG + Intergenic
913686624 1:121238162-121238184 GCTGCCTGCCAGGTAAAATCTGG + Intronic
914038478 1:144025802-144025824 GCTGCCTGCCAGGTAAAATCTGG + Intergenic
914150977 1:145042106-145042128 GCTGCCTGCCAGGTAAAATCTGG - Intronic
915495675 1:156281365-156281387 GCTGCCTGTCAGACAGAGCGTGG - Intronic
916423379 1:164658005-164658027 TCCCACTGTCAGGCAGATTCTGG + Intronic
916683101 1:167121835-167121857 GCTGCCTGGCAGGGAGAGTGAGG - Intronic
916721453 1:167487412-167487434 GCTCCATGGCAGGCAGGTTCAGG + Intronic
917738553 1:177942000-177942022 GCTTCCCGTCTGGCAGATTATGG - Exonic
917921970 1:179758147-179758169 GCTGGCTGCTAGGCAGAATCGGG + Intronic
918041471 1:180916535-180916557 GCTGCCCATCAGGCAGGTTTTGG - Exonic
918125698 1:181581549-181581571 GCTGCCTGTCAGGGATGTTGGGG + Intronic
919782039 1:201227263-201227285 CCTGCCTGTCAGGGAGGCTCCGG + Intronic
920473950 1:206256720-206256742 GCTGCCTGCCAGGTAAAATCTGG + Intronic
921353999 1:214267337-214267359 GCTACCTGTGAGGCAGAGGCAGG + Intergenic
923884132 1:238136460-238136482 CCTGCATGTCAGTCAGCTTCAGG - Intergenic
1064066033 10:12182234-12182256 GCAGCCTGTCACACAGAGTCAGG + Intronic
1066503748 10:36020720-36020742 GCTGCCTCTCAAGCAGACGCTGG - Intergenic
1069657858 10:70103292-70103314 GCACCCTATCAGGCAGTTTCTGG - Intronic
1069663508 10:70139485-70139507 TCTGCCTCTCAGTCAGAGTCAGG - Exonic
1070524473 10:77283388-77283410 GCTGGCTGTCCTGCAGCTTCAGG + Intronic
1071060779 10:81569639-81569661 GCTGCATGGCAGGCAGCTCCAGG + Intergenic
1071516670 10:86302178-86302200 CCAGCCTGGCAGGCAGATCCTGG + Intronic
1072485253 10:95848389-95848411 GCTTGGTGTCAGGCAGAATCGGG + Intronic
1073019883 10:100434241-100434263 TCTGCCAGTCAGCCAGATTTGGG - Intergenic
1075235782 10:120727562-120727584 GCTGGCTGTGAGGGAGAATCTGG + Intergenic
1075557602 10:123444732-123444754 GGTGCCTGGCAGGCACACTCAGG - Intergenic
1075698967 10:124456157-124456179 ACTGCCTGGCATACAGATTCTGG + Intergenic
1076569466 10:131422945-131422967 GGAGCCTGTCAGGCAGAGTGGGG - Intergenic
1076736360 10:132460936-132460958 GCTGCAGGTCAGGCAGAGCCTGG - Intergenic
1077503572 11:2920063-2920085 GCTGCCTGACAGCCAGAGTGCGG + Intronic
1077533235 11:3107030-3107052 GCTGGCTGGCATGCAGATGCGGG - Intronic
1077980265 11:7292919-7292941 GCTGCCTAACAGGAAGGTTCAGG - Intronic
1079259136 11:18861024-18861046 GCTGCCTTTCAGGCAGAAGAGGG - Intergenic
1080277199 11:30515759-30515781 GCTGTCTGTAAGGCAAATTGGGG - Intronic
1081801963 11:45866188-45866210 GCTGCCTCTCAGGCAGCTCAAGG - Intronic
1082106561 11:48227825-48227847 GCTGCCTGTCTGTCACCTTCTGG + Intergenic
1084389735 11:68867252-68867274 GCTGCAAGTCAGGCTGATGCCGG - Intergenic
1084678065 11:70648539-70648561 GCTGGCTATCAGGCAGATATGGG + Intronic
1089160442 11:116432943-116432965 GCTGCCACTCAGGCAGCCTCTGG + Intergenic
1092038778 12:5364739-5364761 TCTGCCTGTCAGGGAGATGAAGG + Intergenic
1093915982 12:24803083-24803105 GCTGTCTGTGAGGCTGAGTCTGG - Intergenic
1097347470 12:58510147-58510169 TGTGCCTGTGAGGCTGATTCTGG + Intergenic
1098980052 12:76946147-76946169 GGTGGATGCCAGGCAGATTCCGG - Intergenic
1104655313 12:130570070-130570092 TCTTCCTGTCAAGCAGATCCGGG - Intronic
1104963337 12:132498363-132498385 CCTGCCTGTCAGACACCTTCTGG + Intronic
1107581770 13:41797140-41797162 GCTGCCTGGGAGGCTGATGCAGG - Intronic
1108915495 13:55605851-55605873 GCCGCCTGTGAGGCTGAGTCTGG - Intergenic
1114703363 14:24701188-24701210 GCTGCCTCACAGTCAGGTTCAGG + Intergenic
1115295328 14:31819708-31819730 GTTGATTGTCTGGCAGATTCTGG - Intronic
1115708428 14:36023052-36023074 GCCTCCTGTCACGCAGACTCCGG - Intergenic
1116297865 14:43135981-43136003 GGTGCCTGTCAGGGAGGCTCGGG + Intergenic
1117396346 14:55314013-55314035 GCTGCCTGTGAGGCTGAGTTAGG - Intronic
1118178414 14:63465820-63465842 GCTGACTCTCAGGCACATCCTGG - Intronic
1118190119 14:63572631-63572653 GCTGCATGTCAGGCTGAGGCAGG - Intergenic
1119805082 14:77477243-77477265 GCATCCACTCAGGCAGATTCTGG - Intronic
1121440507 14:93945893-93945915 CCTGCCTGTCTGGAAGATTCGGG + Intronic
1124332285 15:28831276-28831298 GCTCCCTGGCAGCCAGCTTCTGG - Intergenic
1124795329 15:32772823-32772845 GCTGGCTGGCAGGCATATCCTGG + Exonic
1124932964 15:34141057-34141079 GATGCCTGTCAGGCATATTAAGG + Exonic
1130385101 15:83404192-83404214 GCTGCCAGTCTCTCAGATTCAGG + Intergenic
1130433167 15:83869517-83869539 CCTGCCTGTCAGGGATAATCAGG + Intronic
1135841676 16:25882443-25882465 GCTTCATGGCAGGCAGTTTCAGG + Intronic
1136030188 16:27497050-27497072 GCTGTCTGTCAGGCAGCGTCAGG - Intronic
1136086609 16:27889886-27889908 GCAGGCTGTTAGGAAGATTCGGG - Intronic
1137524575 16:49223581-49223603 GTTGCCTTCCAGGCAGATACTGG - Intergenic
1137559770 16:49495118-49495140 GCTGCCTGCCAGGGAGACACAGG + Intronic
1139382010 16:66538443-66538465 GCTGCCTGTGACCCAGACTCTGG - Intronic
1141756824 16:85996926-85996948 GCCGCCTGGCAGGCAGCTCCAGG - Intergenic
1142148775 16:88503563-88503585 GCTGGCTGTGAGTCAGATGCAGG - Intronic
1143139756 17:4735035-4735057 GATGCCTGTCAGGAAGGCTCTGG + Intronic
1143307359 17:5958073-5958095 GCTGCCTCTCAGGCAGTCCCAGG - Intronic
1146840873 17:36153327-36153349 GGAGCATGTCAGGCAGAATCAGG - Intergenic
1148979232 17:51557225-51557247 TCTGACTGTCAGGAAGATTATGG + Intergenic
1149858657 17:60107641-60107663 GGAGCATGTCAGGCAGAATCAGG + Intergenic
1152945201 17:83194299-83194321 GCTGCCTGCCTGGGAGACTCAGG + Intergenic
1153761180 18:8334135-8334157 GCTCCCTGCCAGGCAGGTGCTGG - Intronic
1154038727 18:10833050-10833072 GCTGCCAGCAAGGCATATTCTGG - Intronic
1154199178 18:12287596-12287618 GCTGCCTGCCAGGCTGACCCAGG + Intergenic
1155064102 18:22254144-22254166 GCTGCCAGTCACGAAGACTCTGG + Intergenic
1156858054 18:41805914-41805936 ACTGCCTGTTTGACAGATTCTGG + Intergenic
1157288452 18:46393349-46393371 TCTGCCTGTCAGGCAGGGCCTGG - Intronic
1158744363 18:60181540-60181562 CTTGCCTGTCAGTCAGATTTAGG + Intergenic
1159456369 18:68664202-68664224 GCTGCTTCTCAGTCAGATTTTGG + Intergenic
1159492004 18:69148613-69148635 ACTCCCTGGCAGGCAGATTATGG + Intergenic
1159820499 18:73135896-73135918 GCTGCCTCATAGACAGATTCTGG - Intergenic
1161408091 19:4101615-4101637 GCTGCCTTTCAGGCTGATGTGGG - Intronic
1162454373 19:10774191-10774213 GCTGCCTGAAAGGCTGAGTCAGG + Intronic
1163583909 19:18153829-18153851 GCGGGCTGGCAGGCAGATCCAGG + Intronic
1163720978 19:18898223-18898245 TCTGCCTGCCAGGCAGGTTGTGG - Intergenic
1165343699 19:35229775-35229797 TCTGCCTGCCTGACAGATTCAGG - Intergenic
1166938775 19:46350556-46350578 GCTGTCTGTCAGGCAGTAGCAGG + Intronic
1167491138 19:49793164-49793186 GCTGCCTCTCAGGGAGAGTGGGG - Intronic
1168654705 19:58118508-58118530 GCTGCCTGGCAGCCAGAACCTGG + Intergenic
925791268 2:7489657-7489679 GCTGGCTATCAGGCAGACTGAGG - Intergenic
927233485 2:20848332-20848354 GCTGCCTATCTTGCAGATTCTGG + Intergenic
928189337 2:29147924-29147946 GCCACCTGTCAAGCAGATTAAGG + Intronic
930099206 2:47590072-47590094 GCTCCCTGCCAGGCTGAATCAGG - Intergenic
931765850 2:65455890-65455912 GCTGCCTGTGAAGGAGATTGAGG - Intergenic
931905048 2:66833517-66833539 ACTGGCAGTAAGGCAGATTCTGG - Intergenic
932766295 2:74472609-74472631 GCGGCCTGTCAAACAGGTTCGGG - Exonic
933477020 2:82803757-82803779 GCTTCCTTTCAGGAAGATTTAGG - Intergenic
935650241 2:105375741-105375763 ACTGCCTGTCAGGGGGACTCGGG + Intronic
937046921 2:118856758-118856780 ACTGCCTGGCAGGGAGATTTGGG - Intergenic
939952870 2:148496225-148496247 GCTCCCTTTCAAGGAGATTCTGG - Intronic
941039428 2:160603807-160603829 GATGTCTGTCAGGCAGAGACTGG - Intergenic
941745420 2:169081753-169081775 GCTGCCTGTCTGACTGAATCAGG + Exonic
942178264 2:173355304-173355326 TCTGCCTGGCAGGCAAAATCGGG - Intronic
944250943 2:197579784-197579806 GCTCCCTGCCAGGCTGAATCAGG + Intronic
945952108 2:216049109-216049131 TCTGGCTGTCAGGGATATTCTGG - Intronic
946414174 2:219531252-219531274 GCTGCTTGTCAGGCTGAAGCAGG + Intronic
947102907 2:226640325-226640347 GATACCTGTCAGGCATATTCTGG - Intergenic
1169147704 20:3264280-3264302 CCTGCCTGTCCGGCAGCTGCTGG - Intronic
1170353953 20:15471757-15471779 GCTGACTGTAAGGAAGATTAGGG - Intronic
1171300878 20:24059392-24059414 CCTGCATGTCAGGCAGATAGGGG - Intergenic
1175751956 20:61504667-61504689 CCTGCATGTCAGGCACAATCTGG + Intronic
1176304271 21:5115078-5115100 GCTGCGTGCCAGGCACCTTCAGG - Intergenic
1177063108 21:16397398-16397420 GCTCCCTGCCAGGCTGAATCAGG - Intergenic
1178797951 21:35763192-35763214 TCTGCCTGTTACCCAGATTCGGG + Intronic
1179852785 21:44146952-44146974 GCTGCGTGCCAGGCACCTTCAGG + Intergenic
1180083266 21:45496443-45496465 CCTGCCTGTCAGGCAGCAGCTGG - Intronic
1181577373 22:23803499-23803521 GCTGCCTGTCAGGCAGATTCTGG + Intronic
1182486377 22:30641445-30641467 GCTGCCTGCCAGACAGATTTGGG + Intronic
1183354796 22:37352365-37352387 GCTGTGTGTCAGGCACATGCTGG + Intergenic
1183356697 22:37363646-37363668 GCTGCCTCTCCGGCATATGCTGG - Intergenic
1183374841 22:37457193-37457215 GTTGCCTCTCAGGCACATGCTGG - Intergenic
1185274229 22:49943508-49943530 CCCGCCTGTCAAGCAGCTTCGGG - Intergenic
949439815 3:4068089-4068111 GCTTCCTGCCAGGCAGAATTAGG + Intronic
952296734 3:32068905-32068927 GCTCCCCGTCAGGCTGAATCAGG + Intronic
952495752 3:33914466-33914488 GCTGCTTCTCAGGCTGATTATGG + Intergenic
953663202 3:44905961-44905983 TCTGCCTCTCAGGCAGATAGTGG - Intronic
957702155 3:83727913-83727935 GCTGTCTGTGAGGCTGAGTCTGG - Intergenic
961427533 3:126859838-126859860 GCTGCCTGTCAGAGACATTGAGG + Intronic
962021229 3:131503670-131503692 GCGGCCTGGCTGGGAGATTCAGG - Intergenic
962412253 3:135151423-135151445 GCTGCCTGAGAAGCAGATGCAGG - Intronic
962935462 3:140076555-140076577 TCTGCCTGTCAGCCAGAGTGTGG - Intronic
963642520 3:147877511-147877533 GCTGTCTGTGAGGCTGAGTCTGG + Intergenic
964151196 3:153526394-153526416 GCTTGGTGCCAGGCAGATTCAGG + Intergenic
966345213 3:178971430-178971452 TTTGCCTGTCAGGCAGAACCAGG - Intergenic
966838617 3:184069312-184069334 GCTGGCTGTGAGGCTGAGTCTGG - Intergenic
968962610 4:3753114-3753136 GCTTGCTCTCAGGCAGGTTCTGG - Intergenic
974173508 4:58295363-58295385 GCTCCCTGCCAGGCTGAATCAGG - Intergenic
974507710 4:62798086-62798108 GCTGACTGTGAGGCTGAGTCTGG - Intergenic
976614345 4:87060905-87060927 GTTGCCAGTCAGGCAATTTCAGG - Intronic
976775988 4:88706746-88706768 GCTGCCTGTCAGGAACACTGGGG - Exonic
978289389 4:107119270-107119292 GCTCCCTCCCAGGCAAATTCTGG - Intronic
978592670 4:110343100-110343122 GCTGCCTGTGAGGCTGAGTCTGG - Intergenic
980791143 4:137620990-137621012 GCTTCCTGTGAGGCAGGCTCTGG - Intergenic
982280225 4:153676601-153676623 GCTTCATGACAGGCAGATTGTGG + Intergenic
982768979 4:159378399-159378421 GGTGCCTGTCAGGGAGGCTCGGG - Intergenic
984225242 4:177027034-177027056 GCTGCCTGTCAGTCAGGATTTGG - Intergenic
986240910 5:5959054-5959076 GCTGACTGTCAGAGAGATACAGG + Intergenic
986391030 5:7288571-7288593 GCTCCCTGGCAGCCAGCTTCTGG - Intergenic
990861529 5:60333003-60333025 GCTGGCTCTAAGGCAGATGCAGG + Intronic
992471172 5:77056338-77056360 GCTGCTTGTCAGGCTGAGGCAGG - Intronic
992894466 5:81234483-81234505 CCTGCCTGTCAGGAAGTCTCTGG - Intronic
994177457 5:96726992-96727014 GCTGCCCATCAGCCACATTCTGG + Intronic
994691443 5:103024969-103024991 GCTGCCAGTTTGGTAGATTCAGG + Intronic
995678949 5:114695750-114695772 GGAGCCTGTCAGGGAGACTCGGG - Intergenic
996095944 5:119399297-119399319 GCTCCCTGGCAGGCAGAAGCTGG - Intronic
997346024 5:133192779-133192801 GCTGCCTACCAGGCCGATTTTGG + Intergenic
997791518 5:136766580-136766602 GCTGGCGCTCAGGCAGATGCAGG - Intergenic
999706168 5:154274159-154274181 GCTGAATGTCATTCAGATTCTGG + Intronic
1001354607 5:171007422-171007444 GCTCCCTGCCAGGCTGAATCAGG - Intronic
1001955859 5:175847770-175847792 GCTGCCTGACTAGCAGAATCGGG - Intronic
1002690711 5:181048090-181048112 GCTCCCTGGCAGGCAGATGCCGG + Exonic
1003280351 6:4685816-4685838 GCTGCCTGGGAGGCTGACTCAGG - Intergenic
1005137978 6:22593325-22593347 GCAGCCAGTGTGGCAGATTCAGG + Intergenic
1006902973 6:37514966-37514988 GCAGCCTGGGAGGCAGACTCAGG + Intergenic
1006953785 6:37848361-37848383 GCTGCCTGACAGGCACCTACAGG - Intronic
1008688003 6:53945780-53945802 CCTGCTTGCCAGGCAGCTTCAGG + Intronic
1013231628 6:108166037-108166059 GCTGCCTGTCAGAGCGCTTCTGG + Intronic
1015244903 6:131064035-131064057 GGTGCGTGTGAGGCAGATGCTGG - Intergenic
1015679686 6:135792104-135792126 GCAGCCTGTCCTGCAGATTTTGG - Intergenic
1018369261 6:163152696-163152718 GCTGCTAGGCAGGCAGATTTTGG - Intronic
1019131965 6:169883444-169883466 GCTGGCTCTCAGGCAGGTTCGGG + Intergenic
1019340503 7:506790-506812 GCTGCCGGTCAGTCACATCCTGG + Intronic
1021659567 7:22906729-22906751 GCTGTAAGTCAGGCAGAATCAGG - Intergenic
1022518088 7:30988248-30988270 GCTGCCTTTGGGGCAGATCCAGG + Intronic
1023803079 7:43851727-43851749 GCTGTCTGTGAGGCTGAATCTGG - Intergenic
1024642468 7:51341489-51341511 GCTGTCTGTAAGCCAGACTCAGG - Intergenic
1026479800 7:70767858-70767880 GCTTCTTGTCAGGGAGACTCAGG + Intronic
1030522294 7:110612883-110612905 TCTGTCAGTCAGGCAGATCCAGG - Intergenic
1036476917 8:9101988-9102010 GCTGGCTGTCAGTCAAAGTCAGG - Intronic
1037882502 8:22579863-22579885 GCTGTCTGTCGGGCAGCATCAGG + Intronic
1038560456 8:28573615-28573637 GCTGTCTGTCAGGTAGAATGAGG - Exonic
1039567935 8:38564568-38564590 GCTGCCTTTGGGGCAGATACAGG + Intergenic
1042699879 8:71600680-71600702 GGAGCCTGGCAGACAGATTCTGG + Intergenic
1046660865 8:116947176-116947198 GCTGCATGCCAGGCAGATTCAGG - Intergenic
1047430254 8:124784956-124784978 GGTGCAAGTCAGGCTGATTCTGG + Intergenic
1049044158 8:140136352-140136374 GCTGCCTGGCAGGCACAAGCAGG + Intronic
1050182445 9:2935091-2935113 GCTGCCGGACAGGCAGCTCCAGG - Intergenic
1050910301 9:11059842-11059864 GCTGCTTGGGAGGCAGAGTCAGG - Intergenic
1053503219 9:38620109-38620131 GCTGCCTGACGCGCAGGTTCCGG - Intergenic
1055218993 9:73905153-73905175 GATGCCAGATAGGCAGATTCTGG + Intergenic
1055852092 9:80644251-80644273 GCTGCCTGGGAGGCTGAATCTGG - Intergenic
1057444007 9:95101156-95101178 GTGGCCTGTCAGGCAGGTCCAGG + Exonic
1057684538 9:97221059-97221081 GCTGCCTGACTCGCAGGTTCCGG - Intergenic
1059491132 9:114668153-114668175 GCTCCCTGTCTGGGAGTTTCTGG + Intergenic
1187428498 X:19200772-19200794 GTGGCCTGTCACGAAGATTCAGG + Intergenic
1188131129 X:26434023-26434045 GCTGTCTGTGAGGCTGAGTCTGG + Intergenic
1188311567 X:28623473-28623495 GCAGCAGGACAGGCAGATTCAGG + Intronic
1188823874 X:34806006-34806028 GCTGCTAGTCATGAAGATTCCGG - Intergenic
1189031902 X:37459852-37459874 GCTCCCTGCCAGGCTGAATCAGG - Intronic
1189463305 X:41259675-41259697 GCAGCCAGTCTGGCAGATGCAGG - Intergenic
1190782098 X:53607542-53607564 GCTGCCTGTCAGGCTGTTGCAGG - Exonic
1191667005 X:63713789-63713811 GCTTCCTGGCATGCACATTCAGG - Intronic
1192022509 X:67408964-67408986 GGTGCCTGTCAGGGAGGCTCGGG - Intergenic
1192220839 X:69196390-69196412 GCTGTCTGTCAGGGGGCTTCAGG + Intergenic
1194634676 X:96330323-96330345 GCTGCCCTTCAGGCTGAGTCTGG + Intergenic
1196694460 X:118596299-118596321 GATGCCCGTCAGGCACATTTCGG + Intronic
1198024255 X:132689303-132689325 ACTTCCTATCAGGCAGATTGTGG - Intronic
1201757021 Y:17497537-17497559 GCTACCTGTGAGGCTGAGTCAGG + Intergenic
1201844532 Y:18408447-18408469 GCTACCTGTGAGGCTGAGTCAGG - Intergenic