ID: 1181577425

View in Genome Browser
Species Human (GRCh38)
Location 22:23803770-23803792
Sequence CTCACACAGCAGAAGCAGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 494
Summary {0: 1, 1: 0, 2: 5, 3: 36, 4: 452}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181577425_1181577430 17 Left 1181577425 22:23803770-23803792 CCACTCTGCTTCTGCTGTGTGAG 0: 1
1: 0
2: 5
3: 36
4: 452
Right 1181577430 22:23803810-23803832 TGCCTCTCTCCTCCTCTAACTGG 0: 1
1: 0
2: 4
3: 31
4: 277

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181577425 Original CRISPR CTCACACAGCAGAAGCAGAG TGG (reversed) Intronic
900956350 1:5888355-5888377 CTCTCACATAAGAAGCAGTGTGG + Intronic
902286936 1:15413100-15413122 CTCGGACAGCGGAAGCAGAACGG - Intronic
902600119 1:17535355-17535377 GTCACACAGCAGGAGGGGAGTGG - Intergenic
902874035 1:19330417-19330439 CTGACACAGCAAAGGCTGAGTGG - Intergenic
903421619 1:23221648-23221670 CTCCCACCTCTGAAGCAGAGGGG - Intergenic
903556581 1:24198044-24198066 GTCACACAGCAGATGGAGACAGG - Intergenic
903761819 1:25703803-25703825 ATCACACTTCAGAAGCAGTGAGG - Intronic
904320824 1:29696961-29696983 CTCACACAGAAGGACAAGAGAGG - Intergenic
904378871 1:30097871-30097893 CTCATACAGAAGAAGAAGAGAGG + Intergenic
904740048 1:32667351-32667373 TTCAGGCAGCTGAAGCAGAGAGG - Intronic
906576681 1:46897518-46897540 GTCCCACTGCAGAAGCACAGTGG - Intergenic
906732780 1:48097595-48097617 CTCACTGAGGAGAAGCAGATTGG - Intergenic
907077578 1:51592588-51592610 CTGACACACAAGAAGCACAGGGG + Intronic
909022850 1:70451493-70451515 TTCACAGAGAAGAAGCTGAGGGG + Intergenic
910713173 1:90202896-90202918 CTCACACAGCAGAAGAATGATGG + Intergenic
910795357 1:91092097-91092119 CACACAGAGCAGAATCTGAGAGG - Intergenic
912691942 1:111811212-111811234 CTCAGACAGAGGAAGAAGAGAGG + Intronic
912711841 1:111955495-111955517 CCCATCCAGCAGAAGCACAGAGG - Intronic
914000610 1:143691642-143691664 CTCAGACAGCGGGAGCAGAAGGG - Intergenic
914197927 1:145459826-145459848 CTCAGACAGCGGGAGCAGAAGGG - Intergenic
914477029 1:148032958-148032980 CTCAGACAGCGGGAGCAGAAGGG - Intergenic
914985275 1:152451055-152451077 CCCCCAGAGCAGAAGCAGAAGGG + Intergenic
915523437 1:156462160-156462182 CTCCCTCAGTAGAGGCAGAGAGG - Intergenic
915783011 1:158574954-158574976 TTAACACAGCAGAAGTATAGGGG - Intergenic
916247592 1:162704630-162704652 CTCACATGGTAGAAGCAGTGAGG + Intronic
917471960 1:175333702-175333724 CTCACATAGCAGAGACAGACAGG + Intronic
917948583 1:180003915-180003937 CTCACACTTTAGAATCAGAGTGG - Intronic
918073125 1:181148406-181148428 CACATACAGCAGAATCTGAGAGG + Intergenic
918317054 1:183331139-183331161 CTCTCCCAGCAAAAGCACAGAGG + Intronic
918531457 1:185526808-185526830 CACACACAGAAGAAACAGAAAGG - Intergenic
918612212 1:186505954-186505976 CTCACACATCAGAGACAAAGAGG - Intergenic
918727452 1:187943559-187943581 CTCACACAGTAGAAGGGGAAAGG - Intergenic
919515858 1:198521909-198521931 GCCACACAGCAGAAGGTGAGTGG + Intergenic
920203737 1:204276569-204276591 CACACAGAGCAGAAGGAGACTGG - Intronic
920312473 1:205056713-205056735 CTGACACCGCAGAAGCAAAACGG + Intronic
921731804 1:218587166-218587188 GCCACACAGCAGAAGGTGAGTGG - Intergenic
922464374 1:225836737-225836759 CAAACTCAGCAGAAGCAGAGAGG + Intronic
923340792 1:233005391-233005413 CTCACTCAGCAGCAGGAGAAAGG + Intronic
923936088 1:238762188-238762210 CTTACAGAGCACAGGCAGAGTGG + Intergenic
924813674 1:247424707-247424729 CTGAAACAGCAGATGGAGAGTGG + Exonic
1063052698 10:2470284-2470306 ATTGCACAGCAGCAGCAGAGTGG - Intergenic
1063702583 10:8400092-8400114 CACACCCAGCAGAACCAAAGAGG - Intergenic
1063927444 10:10994474-10994496 GCCACACAGCAGAAGGTGAGTGG + Intergenic
1064322237 10:14316357-14316379 ATCCCACAGCAAAGGCAGAGGGG - Intronic
1065118080 10:22501557-22501579 CTCACGCAGTAGAATCACAGGGG - Intergenic
1065795079 10:29299234-29299256 GTCACACAGCAGGAGGTGAGCGG - Intronic
1065825456 10:29566718-29566740 CTGAGTCAGAAGAAGCAGAGAGG - Intronic
1065868572 10:29935496-29935518 CCCAGACAGGAGAATCAGAGAGG + Intergenic
1065897569 10:30177747-30177769 CTCATTCAGCAGCAGCAGTGGGG + Intergenic
1065951909 10:30659866-30659888 CTGAGTCAGAAGAAGCAGAGAGG + Intergenic
1066144493 10:32542054-32542076 CTCACAGAGCAGAAACAAAAGGG - Intronic
1067285238 10:44903058-44903080 TTCTCACAGCAAGAGCAGAGGGG + Intergenic
1067543388 10:47174261-47174283 CTCACATGGCAGAAAGAGAGAGG - Intergenic
1068369257 10:56092151-56092173 CACTCACAGCAGAAGGTGAGGGG - Intergenic
1068544290 10:58328492-58328514 GACACACAGCAGAAGATGAGTGG - Intergenic
1068574040 10:58663523-58663545 GTCACACAGCAGGAGGTGAGCGG + Intronic
1069614369 10:69797645-69797667 GGCAGACAACAGAAGCAGAGAGG + Intergenic
1069849043 10:71393262-71393284 CACAGGCAGCAGAAGCAGAAGGG - Intergenic
1070763534 10:79042648-79042670 CACAAACAGCAGAAAAAGAGTGG + Intergenic
1070948465 10:80412054-80412076 CACACCCAGCAGAAGAACAGTGG + Intronic
1071244747 10:83750612-83750634 CTCACAAAGCAGCAGGAGAGAGG - Intergenic
1071529842 10:86380742-86380764 CTCACACTGCAAAGGCAGAGAGG - Intergenic
1071575813 10:86725268-86725290 ATCCCACAGCTGAAGCACAGTGG - Intronic
1072221372 10:93330438-93330460 CTCACCCCACAGAAGCACAGGGG + Intronic
1075318631 10:121471639-121471661 TTCCCACAACAGCAGCAGAGTGG - Intergenic
1075725979 10:124611106-124611128 CTCATTCAGGAGCAGCAGAGTGG + Intronic
1075945632 10:126430699-126430721 CTCATTCAGCAGAAGCAGACAGG + Intronic
1076824908 10:132962021-132962043 CTCACGCGGAGGAAGCAGAGGGG - Intergenic
1076853282 10:133103426-133103448 CTCACACAGCAGAGACACTGGGG - Intronic
1076868476 10:133181235-133181257 CACCCACAGCAGCATCAGAGCGG + Intronic
1077214120 11:1388290-1388312 CACTCACAGCAGCAGCAGCGGGG + Intergenic
1077388148 11:2285094-2285116 CTCAGAAAGCAGAGGAAGAGAGG - Intergenic
1077470674 11:2758908-2758930 CTTGCACAGGAGACGCAGAGGGG + Intronic
1077892178 11:6427036-6427058 CACACACATAAGAAGCTGAGAGG + Intergenic
1078657079 11:13251536-13251558 ATCCCATAGCAGAAGAAGAGAGG + Intergenic
1078849508 11:15151129-15151151 CCCACACAGCAGGAGGTGAGTGG + Intronic
1079145082 11:17843873-17843895 CTAAAACATCAGAACCAGAGGGG + Intronic
1079890278 11:26043061-26043083 CTCACAGAGAGGAAGCAAAGGGG - Intergenic
1079906074 11:26248813-26248835 CGCACACAGCAGGAGGTGAGCGG + Intergenic
1080401205 11:31937617-31937639 CTCACAAGGCAGCAGGAGAGAGG + Intronic
1080593384 11:33744320-33744342 CACAAACAGCAGATGCAGAGAGG + Intronic
1081652910 11:44836793-44836815 TTTACAGAGCACAAGCAGAGTGG - Intronic
1081774174 11:45666102-45666124 CCCACACTTGAGAAGCAGAGGGG - Intergenic
1082746639 11:56969456-56969478 CTCACAGAGCGGAAGGAAAGCGG - Intergenic
1083124018 11:60545078-60545100 ATCACACAGCAGATCCTGAGGGG + Intergenic
1083238707 11:61369825-61369847 CTCACACGCCAGTGGCAGAGCGG + Intergenic
1084179836 11:67440760-67440782 GTCACTATGCAGAAGCAGAGAGG + Intronic
1084888966 11:72227445-72227467 CTCACCCAGCATAAGCAGCCAGG + Intronic
1085043546 11:73340754-73340776 GTCCCACAGCACATGCAGAGTGG - Intronic
1086208321 11:84286873-84286895 ATCTCTCTGCAGAAGCAGAGAGG + Intronic
1087091162 11:94274569-94274591 CTCCAGCAGCAGAAGGAGAGAGG - Intergenic
1087625769 11:100594529-100594551 CACACACAGCAGCAGCAGAGTGG - Intergenic
1087914760 11:103797259-103797281 CCAACAGAGCAGGAGCAGAGAGG + Intergenic
1088341468 11:108772668-108772690 GCCACACAGCAGAAGGTGAGCGG + Intronic
1089765032 11:120757054-120757076 CTGACACAGCAGCAGCATCGTGG + Intronic
1089912580 11:122116938-122116960 CTTACTTAGCAGCAGCAGAGAGG + Intergenic
1090253384 11:125266169-125266191 CTCAGAAAGCACGAGCAGAGAGG + Intronic
1090329630 11:125920844-125920866 TTGGCACAGCAGGAGCAGAGAGG + Intronic
1090819688 11:130330347-130330369 CTCACACAGAAGAAACACAAAGG + Intergenic
1091115582 11:133009812-133009834 GCCACACAGCAGAAGGTGAGTGG - Intronic
1091701992 12:2669540-2669562 CTCACAAAACAGAAGGAGACGGG + Intronic
1091822142 12:3483402-3483424 ATCACACAGCAAGAGAAGAGTGG - Intronic
1091991520 12:4959897-4959919 CTCATACAGAAGGAGCAGAGAGG - Intergenic
1092098251 12:5861830-5861852 CTCACACAGCTGGAGGACAGGGG + Intronic
1093680263 12:21994154-21994176 CTCACATGGCAGAGGCAGAGAGG - Intergenic
1094809071 12:34120551-34120573 CACACACAGCCGAAGCTAAGAGG - Intergenic
1095188126 12:39225288-39225310 GTCACACAGAGGAAGGAGAGAGG - Intergenic
1095830362 12:46579225-46579247 CTAACACAACAGAAGCAGGTGGG - Intergenic
1095951053 12:47782157-47782179 CTCACCCAGCCTAAGCAGAGAGG - Exonic
1096016654 12:48282315-48282337 GCCACACAGCAGAAGGTGAGTGG + Intergenic
1096125545 12:49116747-49116769 CCCACACAGCAGGAGGTGAGGGG + Intergenic
1096227144 12:49873372-49873394 CAAACACAGAAGGAGCAGAGCGG - Intronic
1100610092 12:96184697-96184719 CTCACACGGCAGAAGGAGTGAGG - Intergenic
1101159244 12:101956521-101956543 GCCACACAGCAGAAGGTGAGTGG - Intronic
1102734160 12:115143181-115143203 CTCACACAGCAGAAGGGGCTGGG - Intergenic
1103310970 12:120007820-120007842 ATCACTCAACAGAGGCAGAGTGG - Intronic
1103557735 12:121776176-121776198 GGCTCACAGCAGAAGCAGAGTGG - Exonic
1103931956 12:124455496-124455518 CTCAGAAGGCAGAAGCAGGGAGG - Intronic
1104095042 12:125549349-125549371 CTCACACAGCAGGATCTGAAAGG - Intronic
1104297889 12:127534739-127534761 GTCACACAGCAGGAGGTGAGTGG + Intergenic
1104481642 12:129112913-129112935 TTCACACAGTAGAATCAAAGTGG - Intronic
1105283292 13:18982565-18982587 CTCAAACAGCTGAAACTGAGTGG + Intergenic
1105626334 13:22116520-22116542 TTTACACATCAAAAGCAGAGGGG - Intergenic
1106522706 13:30511926-30511948 CCCACAAAGAAGAATCAGAGAGG - Intronic
1106891980 13:34255521-34255543 CTCAAAAAGGAGAATCAGAGTGG + Intergenic
1107084489 13:36411872-36411894 TTCACAGAGCAGAAGGGGAGAGG + Intergenic
1107269973 13:38603895-38603917 AACACACAGCAGAATGAGAGTGG - Intergenic
1107360564 13:39613261-39613283 CTCACATGGCAGAAGGAGCGAGG + Intergenic
1107372377 13:39766718-39766740 CTCCCACAGAAGAAGCAGATGGG + Intronic
1107396852 13:40026987-40027009 CCCACAGAGCAGCTGCAGAGAGG + Intergenic
1108888238 13:55218608-55218630 CTCAATTAGCAAAAGCAGAGAGG + Intergenic
1110105432 13:71669223-71669245 GCCACACAGCAGGAGCTGAGTGG + Intronic
1110127410 13:71963668-71963690 CTCACCCAGCAGGAGCAGACAGG - Intergenic
1112283978 13:98087707-98087729 TTCAGAAAGCAGAAGCTGAGAGG - Intergenic
1113375651 13:109763038-109763060 CTTTCACACCATAAGCAGAGTGG + Intronic
1113547874 13:111168293-111168315 CTCACACAGCTGTCGCACAGTGG - Intronic
1114652208 14:24292390-24292412 CATTCACAGTAGAAGCAGAGAGG - Intronic
1115418444 14:33164805-33164827 CTGACACAGGAGAAGCAATGGGG - Intronic
1115787256 14:36840070-36840092 CTCCCACAGCAGCAGCACACAGG + Intronic
1115881915 14:37928852-37928874 CTCACACATCAGCAGCTGATAGG - Intronic
1116079294 14:40153559-40153581 CACACCCAGCAGCAGCTGAGTGG + Intergenic
1116334024 14:43634261-43634283 CTCACATAGCAGAAGGTGAAAGG + Intergenic
1117011134 14:51471933-51471955 CTCACATGGCAGAGGCAGAAGGG - Intergenic
1118251857 14:64169473-64169495 CTCACTCAGCATTAGCAGACTGG - Intronic
1118580471 14:67291053-67291075 ATCACACAGGAAAAGCAGGGGGG + Intronic
1118654682 14:67933874-67933896 CTGACTCAGCAGGAGCATAGAGG - Intronic
1118982338 14:70726950-70726972 GCCACACAGCAAAAGCAGAATGG + Intronic
1120330791 14:83090902-83090924 CGCACACGGCAGAAGGAGTGAGG - Intergenic
1120566721 14:86068762-86068784 CTCACATGGCAGAAGGAGTGAGG + Intergenic
1122324836 14:100875773-100875795 CTGACACCACAGAAGCTGAGGGG - Intergenic
1122572642 14:102717655-102717677 CTCACTCAGCAGAGGGAGAAAGG - Intronic
1123489174 15:20766073-20766095 CTCACTCAGGAGAAGGACAGTGG - Intergenic
1123545673 15:21335160-21335182 CTCACTCAGGAGAAGGACAGTGG - Intergenic
1124200853 15:27677446-27677468 CCCATGAAGCAGAAGCAGAGGGG - Intergenic
1125188574 15:36962764-36962786 CTCATGCAACAGAAGCTGAGTGG + Intronic
1126664060 15:51059879-51059901 CTGACCCAGAAGGAGCAGAGAGG - Intronic
1126911517 15:53422033-53422055 GCCACACAGCAGAAGGTGAGTGG + Intergenic
1127048438 15:55052914-55052936 CTCACACCACAGAAGTAGAAGGG - Intergenic
1128258351 15:66214522-66214544 ATGACACAGCAGAAGAAGAAGGG + Intronic
1128302079 15:66572338-66572360 TTAGCAGAGCAGAAGCAGAGAGG - Intergenic
1128556963 15:68638289-68638311 CCCTCACAGGAGAAGGAGAGAGG + Intronic
1129152168 15:73696102-73696124 TTCACAGAGCAGCAGGAGAGAGG - Intronic
1130285405 15:82550486-82550508 CTCAGACAGCATAAGCAGGATGG + Intronic
1130706885 15:86241597-86241619 CTCACATAGCAGAAGGTGAAAGG + Intronic
1130894911 15:88162454-88162476 ATCAGCCAGCAGAAGGAGAGGGG + Intronic
1131325512 15:91439774-91439796 GCCACACAGCAGAAGGAGAGTGG - Intergenic
1131549950 15:93348834-93348856 CTCACAGTCCAGAAGCACAGAGG + Intergenic
1202954017 15_KI270727v1_random:62430-62452 CTCACTCAGGAGAAGGACAGTGG - Intergenic
1132748586 16:1447117-1447139 CCCACACAGCAGAGGCAGGCGGG + Intronic
1132774905 16:1588011-1588033 CTCACACAGGTCAAGCTGAGCGG - Exonic
1133981916 16:10639372-10639394 CTCACACACCAGAGACAGATTGG + Intronic
1134492712 16:14707693-14707715 CTCCCTCAGCAGAAGCGGTGAGG + Intergenic
1134498093 16:14746815-14746837 CTCCCTCAGCAGAAGCGGTGAGG + Intronic
1134839448 16:17390069-17390091 CTCACAAAGCAGCAGGAGAGGGG + Intronic
1134901517 16:17942336-17942358 GCCACACAGCAGAAGTTGAGCGG - Intergenic
1135300323 16:21321228-21321250 ATCACACAGCAGGAGGTGAGCGG - Intergenic
1135313800 16:21426329-21426351 CTCCCTCAGCAGAAGCGGTGAGG - Intronic
1135366724 16:21858609-21858631 CTCCCTCAGCAGAAGCGGTGAGG - Intronic
1135445091 16:22512549-22512571 CTCCCTCAGCAGAAGCGGTGAGG + Intronic
1135839432 16:25861197-25861219 CAGTCACAGCAGAAGCAGTGAGG + Intronic
1135843289 16:25895715-25895737 CTCACACAGCAGAGGGAAAGAGG + Intronic
1136193813 16:28637088-28637110 CTCCCTCAGCAGAAGCGGTGAGG + Intergenic
1136291200 16:29272512-29272534 CTCATCCAACAAAAGCAGAGAGG + Intergenic
1136310464 16:29405032-29405054 CTCCCTCAGCAGAAGCGGTGAGG - Intergenic
1136323912 16:29506820-29506842 CTCCCTCAGCAGAAGCGGTGAGG - Intergenic
1136438597 16:30246803-30246825 CTCCCTCAGCAGAAGCGGTGAGG - Intronic
1137781496 16:51101337-51101359 CTCACAGGGTAGAAGCAGTGAGG - Intergenic
1139054737 16:63168811-63168833 TTCACACAGCAGAAGGAATGAGG - Intergenic
1139858148 16:69997418-69997440 CTCCCTCAGCAGAAGCGGTGAGG - Intergenic
1139877285 16:70156502-70156524 CTCCTGCAGCAGAAGCAGAATGG + Exonic
1140022222 16:71249266-71249288 ATCACACACTAGATGCAGAGAGG + Intergenic
1140241428 16:73204592-73204614 GTCACACAGCAGGAGGTGAGTGG - Intergenic
1140599532 16:76458712-76458734 ATCACACAGCAGAAGGTGAGTGG - Intronic
1141160149 16:81624010-81624032 CTGTATCAGCAGAAGCAGAGGGG - Intronic
1141456939 16:84149057-84149079 CACAGCCAGCAGAAACAGAGTGG + Exonic
1142097070 16:88245973-88245995 CTCATCCAACAAAAGCAGAGAGG + Intergenic
1143724389 17:8835455-8835477 CTCTGAGGGCAGAAGCAGAGGGG + Exonic
1144267628 17:13586388-13586410 TTTCCACAGCAGAACCAGAGGGG + Intronic
1144287520 17:13792310-13792332 CTCACACAGAAGAATGTGAGAGG + Intergenic
1144404901 17:14942786-14942808 CTCACCCAGCATAACCACAGAGG + Intergenic
1144417756 17:15068183-15068205 CTCACATAGCAGAAGGTGAACGG + Intergenic
1144959375 17:19036242-19036264 ATCACACAGCAGAGGCAGGCAGG + Intronic
1144975784 17:19138282-19138304 ATCACACAGCAGAGGCAGGCAGG - Intronic
1146439511 17:32881619-32881641 ATCACAGAGCAGAAGTAGAAAGG + Intergenic
1146443288 17:32915789-32915811 CTCCCACAGTGGAAGCAGACAGG + Intergenic
1146591036 17:34128188-34128210 CTAACACATCAGAAGCTGTGAGG + Intronic
1146837006 17:36119053-36119075 GCCACACAGCAGAAGGTGAGTGG + Intergenic
1147554097 17:41465387-41465409 GCCACACAGCAGAGGTAGAGTGG - Intronic
1149384208 17:56125847-56125869 CCCACACAGCAGGGGCAGACAGG + Intronic
1150625857 17:66840716-66840738 CCCACACAGGAGGAGCAGAGGGG - Intronic
1151726556 17:75888477-75888499 CTCCCACCTCAGAAGCAGAAAGG + Intronic
1151901607 17:77019666-77019688 CTCACACAGTAGAAGGAAAGAGG + Intergenic
1153010245 18:532172-532194 TTGGCACAGCAGAAGCAGCGTGG + Intergenic
1154119594 18:11640690-11640712 CTCCCTCAGCAGAAGCGGTGAGG - Intergenic
1155317978 18:24591192-24591214 CTCCAACAGCAGTAGTAGAGTGG + Intergenic
1155914085 18:31538961-31538983 CTTACATAGCAGGAGCAGAAAGG - Exonic
1156191054 18:34720740-34720762 CCCACACCACAGAATCAGAGTGG - Intronic
1156886246 18:42139676-42139698 CTCACATGGCAGAAGCAGAAGGG + Intergenic
1157161118 18:45315375-45315397 CTTACCCAGCAGAAGGAGGGTGG + Intronic
1157171458 18:45410225-45410247 ACCACACAGCAGAAGATGAGCGG - Intronic
1157640411 18:49207128-49207150 CTCACCTAGCAGGAGCAGACAGG - Intronic
1157841763 18:50965890-50965912 GCCACACAGCAGAAGGTGAGCGG + Intergenic
1159148900 18:64494613-64494635 CTGATACAACAGAAGCAGAAGGG + Intergenic
1159202959 18:65211387-65211409 TTCACACGGCAGAAGGAGAGGGG - Intergenic
1159670891 18:71219384-71219406 GTCACACAGCAGGAGGTGAGTGG - Intergenic
1160239016 18:77109334-77109356 CACACACAACTGAAGCACAGGGG + Intronic
1160541651 18:79627285-79627307 CTCACGCTTCAGGAGCAGAGGGG + Intergenic
1160753991 19:748248-748270 GTCACACACCAGAAGCAGAGGGG - Exonic
1161207562 19:3049295-3049317 CTCACCCACCAAAAGCAGGGTGG - Intergenic
1162030863 19:7916707-7916729 CTCACGCAGCAGAGCCAGGGCGG - Exonic
1163121143 19:15218803-15218825 GCCATACAGCAGAAGCTGAGTGG - Intergenic
1163223527 19:15938730-15938752 ACCACACAGCAGAAGGTGAGCGG - Intergenic
1164063541 19:21695167-21695189 CTCTCTCAGCAGGAGGAGAGGGG + Intergenic
1164547715 19:29182991-29183013 CCTACTCGGCAGAAGCAGAGAGG - Intergenic
1164665738 19:30034749-30034771 CCCAAACAGCAGAAAAAGAGTGG - Intergenic
1164820126 19:31243602-31243624 CTCAAATAGCAGAAGCAGAGGGG + Intergenic
1165153682 19:33774980-33775002 CTGAGACAGCAGATGCTGAGGGG + Intergenic
1165285989 19:34841978-34842000 GTCACACAGCAGGAGGTGAGTGG + Intergenic
1166089898 19:40502105-40502127 CTGACACAGCAGAGGAAGGGGGG - Intronic
1166269064 19:41702459-41702481 ACCTCACAGCAGGAGCAGAGTGG + Intronic
1166312369 19:41969990-41970012 CGCACACATCAACAGCAGAGAGG + Intronic
1166382068 19:42360329-42360351 AAAAAACAGCAGAAGCAGAGAGG - Intronic
1167603490 19:50467639-50467661 AGGGCACAGCAGAAGCAGAGAGG + Exonic
925213613 2:2073017-2073039 TTCACACAACAGAAGGAGGGAGG + Intronic
925339523 2:3126515-3126537 CTCAACCAGCAGCAGCAGAGGGG + Intergenic
927085693 2:19672365-19672387 GACACACTTCAGAAGCAGAGAGG + Intergenic
927881359 2:26692341-26692363 CTCAGACAGAAAAAGAAGAGAGG - Intergenic
928275090 2:29893298-29893320 GTCACTCATCAGAAGCAGATGGG - Intronic
929314963 2:40465975-40465997 CTCACATAGCAGAAGCCAGGAGG - Intronic
929834600 2:45383668-45383690 CTAACACAGGAAAAGAAGAGTGG - Intergenic
930003775 2:46880101-46880123 CTAATACAGCAAAATCAGAGTGG + Intergenic
930029599 2:47049983-47050005 CTCACCATGAAGAAGCAGAGTGG + Exonic
930134559 2:47887976-47887998 CTCACCCAGCAGGAACACAGTGG - Intronic
930180572 2:48351738-48351760 GTCACAGAGCAGGAGGAGAGTGG - Intronic
932331854 2:70902151-70902173 CACACCCAGCAGCCGCAGAGAGG - Intronic
933467440 2:82672511-82672533 TTCAGAGAGCAGAAGCAGAATGG + Intergenic
933606991 2:84393629-84393651 CACAGACAGCAGAGGCAGAGTGG - Intergenic
934975232 2:98797447-98797469 GTCACTCGGCAGAAGCGGAGGGG - Exonic
935708332 2:105875618-105875640 CTCACATGGCAGAAGCAGCAAGG - Intronic
936055775 2:109260897-109260919 CTCTCACAGCAGAGGCAGGATGG - Intronic
937588839 2:123590061-123590083 GAGACACAGCAGAAGGAGAGTGG + Intergenic
940670434 2:156660952-156660974 GCCACACAGCAGAAGGTGAGTGG + Intergenic
941798283 2:169625991-169626013 GTCACACAGCAGAAGGTGAGTGG - Intronic
945102554 2:206275107-206275129 CTCACGCAGCAGGGGCAGAAAGG - Intronic
945776924 2:214116527-214116549 GTCACACAGCAGATCCTGAGAGG + Intronic
946201905 2:218075487-218075509 CTCACAAAAAGGAAGCAGAGTGG + Exonic
947383243 2:229564951-229564973 CTCACATAGCAGGAGAAGTGAGG + Intronic
947896678 2:233680816-233680838 TTCAGAATGCAGAAGCAGAGTGG + Intronic
948332129 2:237178004-237178026 CTCACAGAGCAGAGAGAGAGAGG - Intergenic
948570817 2:238916017-238916039 AACACACAGAAGAAGCACAGAGG + Intergenic
1169353488 20:4889091-4889113 TTCACGCAGCAGAAACAGAAGGG - Intronic
1169902475 20:10567403-10567425 CTCACACGGCAGAAGGAGGAAGG - Intronic
1170307505 20:14955796-14955818 CTTACAGAGCTGAAGGAGAGAGG + Intronic
1170408497 20:16064440-16064462 CTGACACAGCAACAGAAGAGAGG - Intergenic
1170957049 20:20991167-20991189 CTCACATGGCAGAAGGGGAGAGG + Intergenic
1171490960 20:25516828-25516850 AGCACACAGCAGAAGGAGCGGGG + Intronic
1172056762 20:32159543-32159565 GTCACACAGATGAAACAGAGGGG - Intronic
1172654795 20:36530076-36530098 CTGCCACAGCAGAAGCAGGAAGG - Intergenic
1173096870 20:40041722-40041744 CTCACACAGCACAGCCTGAGAGG + Intergenic
1173237528 20:41261104-41261126 CTCACACATCATTAGCAAAGAGG + Intronic
1174362480 20:50037682-50037704 CTCACCCCGCAGAAGAAGATGGG - Intergenic
1174590840 20:51643540-51643562 CTCTCGCAGCAGAAGGAGCGAGG - Intronic
1174849806 20:53982149-53982171 CTTACACAACAGAATCAGAAAGG - Intronic
1174868087 20:54157324-54157346 TTCACAAGGCAGAAGAAGAGAGG - Intronic
1177173410 21:17678163-17678185 TTCACACAGCAGGAGGTGAGCGG + Intergenic
1177393852 21:20508468-20508490 CTCACAGAGAGGAAGCAAAGTGG - Intergenic
1178121425 21:29473946-29473968 GTCACTCTGCAGAAGCAGAATGG - Intronic
1178427838 21:32492899-32492921 CTCACACAGCTAGAGAAGAGCGG - Intronic
1178427840 21:32492931-32492953 CTGAGACAGCAGACACAGAGAGG - Intronic
1178510602 21:33202081-33202103 CTCACACAAAAGAAGCACTGTGG + Intergenic
1178590328 21:33904278-33904300 CACACAGAGCAGAGGCAGGGAGG - Intronic
1178699631 21:34822002-34822024 CTCACACAGCAGAACTATAAAGG + Intronic
1178975361 21:37216689-37216711 CTCACACTGCGGACGCGGAGGGG - Intergenic
1179412956 21:41176190-41176212 CACACAAAGCTGAAGCAGATTGG - Intronic
1179441347 21:41396698-41396720 CACTCAGAGCAGGAGCAGAGAGG - Intronic
1180351932 22:11812959-11812981 CTCCCAGAGCAGCAGCCGAGGGG + Intergenic
1181161168 22:20960765-20960787 TTCACACAGAAGAAACAGTGTGG - Intergenic
1181345143 22:22214627-22214649 CTCAAAGATCTGAAGCAGAGAGG - Intergenic
1181345854 22:22220161-22220183 CCCAGGCAGCACAAGCAGAGGGG - Intergenic
1181577425 22:23803770-23803792 CTCACACAGCAGAAGCAGAGTGG - Intronic
1181832325 22:25570722-25570744 AAGACACAGGAGAAGCAGAGGGG - Intronic
1182347822 22:29679178-29679200 ATCCCACAGCTGATGCAGAGGGG + Intronic
1182996201 22:34814852-34814874 CTCACACTGAGTAAGCAGAGTGG - Intergenic
1183012394 22:34957590-34957612 CTCACATGGCAGAAGGAGTGAGG + Intergenic
1184726149 22:46347805-46347827 CTGACCCAGCAGAAGCAGCAGGG - Intronic
949264386 3:2139788-2139810 AAAACACATCAGAAGCAGAGTGG - Intronic
949497817 3:4649815-4649837 CTCACATGGCAGAAAGAGAGGGG + Intronic
950363768 3:12468671-12468693 TTCTCACATCAGAAGCACAGAGG + Intergenic
951462176 3:22963245-22963267 CTCACACAGCAGAAGGGGTAAGG - Intergenic
952484038 3:33791329-33791351 CTCACATAGCAGAGTGAGAGAGG + Intergenic
954301536 3:49703153-49703175 TTCACTCAGGAGAAGCAGAGAGG - Intronic
954571338 3:51643524-51643546 CTCACAAGGCTGAGGCAGAGAGG + Intronic
955466596 3:59243419-59243441 CTCACAAGGCAGAAGGAGTGAGG - Intergenic
955495911 3:59532152-59532174 GTCACACAGCAGACACAGAAGGG - Intergenic
956343247 3:68249501-68249523 ATCAAACAGCATAAGAAGAGTGG + Intronic
956784786 3:72633491-72633513 AGCAGCCAGCAGAAGCAGAGGGG + Intergenic
959671133 3:108978668-108978690 CTCAAACAGTAGAAGCAGGTAGG - Intronic
960041457 3:113153805-113153827 CTCACAGAGCAGAACCAAAACGG - Intergenic
960053601 3:113260568-113260590 GTCACACAGCAGGAGGTGAGCGG + Intronic
960208239 3:114929264-114929286 CTGAAAAAACAGAAGCAGAGAGG + Intronic
961141915 3:124563037-124563059 CTCACACTCCCGAAGCAGCGTGG + Intronic
961320519 3:126070247-126070269 GCCACACAGCAGAAGGTGAGCGG + Intronic
962717365 3:138138239-138138261 CTCACACAATAGCAGCAGGGAGG - Intergenic
963533024 3:146495571-146495593 CTCACAGGGCAGAAGCGGGGAGG - Intronic
963573976 3:147035508-147035530 CACACACAATAGAAGAAGAGTGG + Intergenic
964380487 3:156094208-156094230 GTCACACAGCAGGAGGTGAGCGG - Intronic
964472338 3:157068706-157068728 CTCACACAGGTGAAGCAGGACGG + Intergenic
964725150 3:159806707-159806729 CTCACACTGGAGAAGCTGCGGGG + Intronic
965665323 3:171087573-171087595 CTCACACAGCATAGGCATACGGG + Intronic
965845352 3:172954581-172954603 CTCTCCCAGAAGATGCAGAGAGG - Intronic
966584268 3:181604090-181604112 GCCACACAGCAGGAGCTGAGTGG - Intergenic
966736345 3:183189986-183190008 CTCCTACAGCAGAGGCAGACTGG - Intronic
967147864 3:186621088-186621110 CTCACAGGACAGAAGCAGAGTGG + Exonic
968731788 4:2272611-2272633 TTGACACAGCAGAAGCACACAGG - Intronic
969109959 4:4838423-4838445 CTCATCCAGCAGCAGCAGTGGGG - Intergenic
969428635 4:7140158-7140180 CTTACACAGCAGAAACAGAGAGG + Intergenic
970413750 4:15836285-15836307 CTTACATGGCAGAGGCAGAGGGG + Intronic
970455526 4:16219996-16220018 CTGGCAGAGCAGAAGCAGCGAGG - Intronic
970466239 4:16325855-16325877 CAGAAAAAGCAGAAGCAGAGAGG + Intergenic
971080024 4:23199060-23199082 CTCACCCAACAGAAGTATAGAGG - Intergenic
971599583 4:28575321-28575343 CTCACATGGCAGAAGGGGAGAGG + Intergenic
971811053 4:31427763-31427785 CTGACACCTCAGAAGGAGAGAGG + Intergenic
972177198 4:36422719-36422741 CTCACACAGCTGAAGCGGGATGG - Intergenic
972883737 4:43458604-43458626 CTGACAGAGCAGAGGCAGAAAGG - Intergenic
977320009 4:95501944-95501966 CAGCCACAGCAGAAGAAGAGAGG + Intronic
977537781 4:98276154-98276176 CTCACACGGTAGAAGGAGTGAGG + Intronic
977753179 4:100633877-100633899 ATGTCACAGCTGAAGCAGAGAGG + Intronic
978526458 4:109672141-109672163 CTCACACAGGAGAATAAAAGAGG - Intronic
978555863 4:109979714-109979736 ATCACCCAGCAGTTGCAGAGTGG - Intronic
978867415 4:113530660-113530682 TTCACATGGCAGAAACAGAGAGG - Intronic
979309231 4:119182749-119182771 GTCACACAGCAGAAGGTGAGCGG - Intronic
979678333 4:123433730-123433752 CACACTCAGCACAAGCACAGAGG + Intergenic
980508233 4:133751649-133751671 CTCAAACAGCAAAATCACAGTGG + Intergenic
980647917 4:135668337-135668359 GTCACACCGCAGAGGCAGAATGG - Intergenic
980763910 4:137273346-137273368 CTCACATAGCAGAAGGTGAAAGG + Intergenic
980797363 4:137701587-137701609 CTAGCACAGAAGCAGCAGAGTGG + Intergenic
981073965 4:140572655-140572677 GGCACAAAGAAGAAGCAGAGAGG + Intergenic
982104257 4:151997875-151997897 GTCACACAGCAGGAGGTGAGTGG + Intergenic
983031762 4:162811479-162811501 GTCACACAGCAGCAGGTGAGTGG - Intergenic
983083831 4:163419223-163419245 CTCACACAGCCAAATCTGAGTGG - Intergenic
983251841 4:165354447-165354469 GTCACACAGCAGGAGGTGAGTGG - Intergenic
983578789 4:169287069-169287091 GTCACACAGCAGGAGTTGAGTGG - Intergenic
984086907 4:175324959-175324981 CTCACAGAGCAGAAACCTAGAGG - Intergenic
985607910 5:868535-868557 CTCCAACAACAGGAGCAGAGTGG + Intronic
985861622 5:2476024-2476046 AAAACTCAGCAGAAGCAGAGGGG + Intergenic
985930802 5:3056155-3056177 CTCACAGAGGAGAGGCGGAGGGG + Intergenic
986087751 5:4468612-4468634 CTGACTCAGCAGGAGGAGAGAGG - Intergenic
986214426 5:5705692-5705714 CTCACAGAGCAGAAGGAATGAGG + Intergenic
987059225 5:14226104-14226126 CTCACACAGGAGAGGCAAGGAGG + Intronic
987670984 5:21008213-21008235 CTCACAAAGCAGAGGCTTAGGGG + Intergenic
987758102 5:22123207-22123229 CTCACATAGCAGAAGGAATGAGG - Intronic
988424701 5:31050019-31050041 CTCACTAAGCAGAAGCATTGAGG + Intergenic
989154828 5:38334426-38334448 TTCACATAGCAGAAGGGGAGGGG + Intronic
989275214 5:39580836-39580858 TTCAGACATCAGCAGCAGAGAGG - Intergenic
990986247 5:61643373-61643395 CGCAGACAGCATAAGAAGAGTGG - Exonic
991004024 5:61810275-61810297 ATCCCTCACCAGAAGCAGAGGGG + Intergenic
993861786 5:93145264-93145286 CACACTGAGCAGACGCAGAGTGG - Intergenic
993913137 5:93708649-93708671 GTCACACAGCAGGAGGTGAGCGG - Intronic
995532792 5:113107801-113107823 CTCTCACAGCAGAGCCGGAGTGG + Intronic
997295884 5:132768122-132768144 CACACACAGCAACTGCAGAGTGG + Intronic
997384836 5:133464500-133464522 CAAACACAGCATCAGCAGAGGGG + Intronic
998200629 5:140115107-140115129 CTCACCCTGCAGTAGCAGGGTGG - Exonic
998333833 5:141352575-141352597 ATCACACAGCAGATCCTGAGGGG - Exonic
999191305 5:149749456-149749478 CTCAGACAGCAGTAGCGGAGGGG - Intronic
999650024 5:153756225-153756247 ATCCCACAGCAGATCCAGAGGGG + Intronic
1001443080 5:171761064-171761086 GTCACACAGAAGTGGCAGAGTGG + Intergenic
1001629113 5:173161380-173161402 CTCCCACAGCACACGCTGAGAGG - Intronic
1004034725 6:11912442-11912464 CTCACACAGCAGGAGGTGGGTGG + Intergenic
1004897121 6:20159203-20159225 GCCACACAGCAGAAGGTGAGTGG + Intronic
1004897287 6:20161036-20161058 GCCACACAGCAGAAGGTGAGTGG + Intronic
1005033132 6:21530031-21530053 CCCACACTGCAGAAGGAGACAGG - Intergenic
1005388138 6:25306285-25306307 GTCACACAGCAGGAGGTGAGCGG + Intronic
1006703027 6:35992505-35992527 CTCACATAGAAGAAGGAGATGGG + Exonic
1006826250 6:36938464-36938486 CTCACATTGCAGAAGGGGAGTGG + Intergenic
1007343885 6:41213324-41213346 GCCACACAGCAGGAGCTGAGTGG + Intergenic
1008192918 6:48482065-48482087 GTCACACAGCAGGAGGTGAGTGG - Intergenic
1009625180 6:66130034-66130056 CTAACACAGCAGAAGAACACTGG + Intergenic
1009750975 6:67879132-67879154 CAAAAACAGCAGAAGCAGAAAGG + Intergenic
1011217301 6:85018599-85018621 CTGAGACCGCAGAGGCAGAGTGG - Intergenic
1012352064 6:98264160-98264182 CTCACATAGCAGAAGGACTGAGG + Intergenic
1013460171 6:110367101-110367123 GTCCCACAGCAGATGCAGGGTGG + Intergenic
1013697333 6:112719175-112719197 GTCACACAGCAGGAGGTGAGTGG - Intergenic
1015938188 6:138423959-138423981 CCCACAGCACAGAAGCAGAGTGG + Exonic
1016074043 6:139775362-139775384 CACACATAGCAGAGGCAGAGTGG + Intergenic
1017594382 6:156013229-156013251 CACACACAGCAGCAGCAGCAAGG + Intergenic
1019556598 7:1634535-1634557 CTCACTCAGCTGAAGCACACAGG - Intergenic
1021375350 7:19900360-19900382 GTCACACAGCAGTAGAACAGTGG + Intergenic
1022096228 7:27143184-27143206 CACCCACATCAGCAGCAGAGAGG - Exonic
1022119202 7:27290964-27290986 GTCACGCAGCAGAAGCATACTGG - Intergenic
1022291557 7:29009133-29009155 CACACACAGCGAAGGCAGAGTGG - Intronic
1022673734 7:32479155-32479177 CACACACAGGAGAAGAAGGGAGG - Intergenic
1022748040 7:33192808-33192830 CTCACATGGCAGAAGAACAGAGG + Intronic
1022881841 7:34595747-34595769 CCCACACAGCAGGAGGTGAGTGG + Intergenic
1023327024 7:39071394-39071416 GCCACACAGCAGGAGGAGAGCGG - Intronic
1023668664 7:42553273-42553295 CTAACACAGCAGGAGGTGAGTGG - Intergenic
1023974513 7:45018217-45018239 CGCACACAGCAGGAGGTGAGTGG - Intronic
1023988875 7:45115990-45116012 CTCACATGGCAGAAGGAGAAAGG - Intergenic
1024236221 7:47401107-47401129 CGCACCCAGCAGCAGCAGTGTGG - Intronic
1026198235 7:68191478-68191500 CTCACCCAGCAGATCCAGACAGG - Intergenic
1026826773 7:73587376-73587398 CTCACACAGCAGGACCTGGGAGG + Intergenic
1027940103 7:84667458-84667480 CTGACACAGGAGAAGAAGAAAGG - Intergenic
1028311003 7:89335720-89335742 CAAACACTGCAGAAGGAGAGAGG + Exonic
1028915300 7:96252484-96252506 CTCTCACAGAAGCAGCAGGGAGG + Intronic
1029551281 7:101238338-101238360 CTGACAGAGCAGAAGCTCAGGGG - Exonic
1031118652 7:117695574-117695596 GTCCCAAAGCAGATGCAGAGGGG + Intronic
1031514789 7:122688557-122688579 CTCAAACAGCTGAGACAGAGCGG - Intronic
1031906656 7:127467207-127467229 CTCACATAGCAGAAGGGGCGAGG - Intergenic
1032271013 7:130405924-130405946 CAGACACCGCAGAAGCAGAGAGG + Intronic
1034282669 7:149864781-149864803 CTCCCACAGCAGAAGCAGTGAGG + Exonic
1035262120 7:157668660-157668682 AACACACAGCAGAAGCCGCGGGG + Intronic
1035263704 7:157676986-157677008 CTCACACAGCACCAGGGGAGGGG - Intronic
1037372094 8:18191024-18191046 GTCACTCAGCAGAAGCACAGTGG - Intronic
1038926872 8:32150502-32150524 CTCACATGGCAGAAGCAGAAGGG - Intronic
1039563158 8:38529148-38529170 CTCACACAGGAGAGGGAGTGTGG + Intergenic
1039600037 8:38828734-38828756 AGGACACAGCAGAAGCAGGGAGG - Intronic
1039906783 8:41792142-41792164 CTCAGAGAGCAGCAGCCGAGGGG + Intronic
1040463137 8:47669427-47669449 CTCACACAGCTGCAGCTCAGAGG - Intronic
1040729463 8:50425268-50425290 GTCACACAGCAGGAGGTGAGCGG + Intronic
1041118603 8:54564601-54564623 CACACACTGAATAAGCAGAGAGG + Intergenic
1041261596 8:56025299-56025321 CTCACAGAGGAGAATCTGAGGGG + Intergenic
1041332930 8:56747983-56748005 GTCACACAGCAGGAGGTGAGTGG + Intergenic
1041451121 8:58007647-58007669 CTCACACAGCTGAAGGAGGAGGG - Intronic
1041804086 8:61831284-61831306 CTCAGACAGCACAAGCACAACGG - Intergenic
1042288461 8:67140748-67140770 CCCAAACAGCAGCATCAGAGTGG - Intronic
1042318604 8:67451199-67451221 GCCACACAGCAGAAGGTGAGTGG + Intronic
1042655565 8:71091849-71091871 CTCACAGAGCAGGGACAGAGGGG - Intergenic
1043651187 8:82594548-82594570 TTCACATAGCAGAAAGAGAGAGG - Intergenic
1043799276 8:84587045-84587067 CTCACACTTAAGAAGCAGAAAGG + Intronic
1044539745 8:93395284-93395306 GTCACACAGCAGGAGGTGAGTGG - Intergenic
1045175995 8:99725315-99725337 GCCACACAGCAGAAGGTGAGTGG + Intronic
1045885947 8:107097952-107097974 GCCACACAGCAGAAGATGAGTGG - Intergenic
1045935502 8:107674199-107674221 CTCATACAGCAGAAGAATAAAGG - Intergenic
1045946736 8:107805087-107805109 GTCACACAGCAGGAGGTGAGTGG - Intergenic
1045952098 8:107864150-107864172 TTCACACAGCAGCAGCAAAAAGG + Intergenic
1046382268 8:113466914-113466936 CTCACATAGGAGAAGCAGAAGGG - Intergenic
1046689444 8:117266772-117266794 CTCACAAGGCAGAAGGAAAGGGG + Intergenic
1047252868 8:123193779-123193801 CTCACATGGCAGAAGGAGTGAGG + Intronic
1047449971 8:124956397-124956419 ATCACAGGGCAGAAGCAGAGGGG - Intergenic
1048080545 8:131121875-131121897 CTCTCTCAGCAGAGGCAGAAGGG + Intergenic
1048583877 8:135755088-135755110 GTCACACAGCAGGAGGTGAGTGG + Intergenic
1050663894 9:7913469-7913491 GCCACACAGCAGAAGGTGAGTGG - Intergenic
1050923878 9:11239647-11239669 GCCACACAGCAGAAGGTGAGTGG + Intergenic
1051334251 9:16052344-16052366 GTCTCACAGCAGCAGCAGACAGG - Intronic
1051468818 9:17411573-17411595 CTTACACAGCAGAAGGTGAGAGG + Intronic
1053002038 9:34582350-34582372 CTCAGAGAGCAGAAGCAGCTTGG + Intronic
1053344952 9:37371402-37371424 CAAACACAGCAGGAGCACAGGGG + Intergenic
1055670113 9:78596031-78596053 CTCACATAGCAGAAGATGAAAGG - Intergenic
1055771684 9:79723593-79723615 CTCACATACCAGTAGGAGAGAGG - Intronic
1057035108 9:91806324-91806346 CTCACATGGCAGAAGGAGAAAGG + Intronic
1058021896 9:100098775-100098797 CTCACTCACCAGGAGCAGAAGGG + Exonic
1058190514 9:101909144-101909166 GTCACACAGCAGGAGGTGAGCGG - Intergenic
1058421058 9:104833870-104833892 CTCAATCAGCAGATCCAGAGGGG + Intronic
1058736909 9:107902159-107902181 CTCACACAGTAGAAGGGGTGAGG + Intergenic
1059173373 9:112147405-112147427 CTGAGACAGGAGAAGCACAGGGG + Intronic
1060268804 9:122127276-122127298 CTCACCCCGCAGAACTAGAGGGG + Intergenic
1061409113 9:130409020-130409042 TGTACACTGCAGAAGCAGAGGGG - Intronic
1062131841 9:134899982-134900004 CTGACACTGCAGGAGTAGAGGGG - Intergenic
1062217356 9:135396389-135396411 CCCACACAGCAGGAGGTGAGTGG + Intergenic
1185518201 X:716579-716601 ATCACACAGAACACGCAGAGAGG - Intergenic
1186206025 X:7201575-7201597 CTCCCACAGCACAAGCAGAAAGG - Intergenic
1187389781 X:18878365-18878387 CACTCATAGCAGAGGCAGAGTGG - Intergenic
1187852763 X:23607222-23607244 CTCACACAGGAAAAGAAGACGGG + Intergenic
1192557253 X:72100550-72100572 GTCACACAGCAGGAGGTGAGTGG + Intergenic
1192794786 X:74418053-74418075 GTCACACAGCAGGAGGTGAGCGG - Intergenic
1193615162 X:83678395-83678417 CTCATAGAGCACAAGCATAGTGG + Intergenic
1194162150 X:90467287-90467309 ATCCCACAGCAGAAGTTGAGAGG + Intergenic
1194925406 X:99817780-99817802 CTCACCCAGCACAATCATAGTGG + Intergenic
1195219189 X:102730362-102730384 GTCACACAGCAGGAGGTGAGTGG - Intronic
1195361167 X:104085018-104085040 CTGCCAAAGCAGAGGCAGAGAGG + Intergenic
1197312300 X:124919626-124919648 ATCACACAGCAGAGGCAAAAAGG + Intronic
1198035786 X:132800095-132800117 GTCACACAGCAGGAGGTGAGCGG + Intronic
1199380363 X:147165265-147165287 CTCCCACAGCAGATGCTGAAGGG - Intergenic
1200508427 Y:4045024-4045046 ATCCCACAGCAGAAGTTGAGAGG + Intergenic
1201690070 Y:16753324-16753346 CCCAAAGAGCAGAAGCAGGGTGG - Intergenic