ID: 1181577710

View in Genome Browser
Species Human (GRCh38)
Location 22:23805933-23805955
Sequence CTTGCATCCTTTCTGGAACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181577710_1181577714 0 Left 1181577710 22:23805933-23805955 CCCTGTTCCAGAAAGGATGCAAG No data
Right 1181577714 22:23805956-23805978 GAAGCTTACCATAAGTACACTGG 0: 1
1: 0
2: 0
3: 6
4: 62
1181577710_1181577719 29 Left 1181577710 22:23805933-23805955 CCCTGTTCCAGAAAGGATGCAAG No data
Right 1181577719 22:23805985-23806007 ATGACTAAAGCAAATGAAAACGG 0: 1
1: 1
2: 6
3: 60
4: 670
1181577710_1181577715 1 Left 1181577710 22:23805933-23805955 CCCTGTTCCAGAAAGGATGCAAG No data
Right 1181577715 22:23805957-23805979 AAGCTTACCATAAGTACACTGGG 0: 1
1: 0
2: 1
3: 8
4: 74

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181577710 Original CRISPR CTTGCATCCTTTCTGGAACA GGG (reversed) Intronic
No off target data available for this crispr