ID: 1181579872

View in Genome Browser
Species Human (GRCh38)
Location 22:23822223-23822245
Sequence CAGTTCCAGCAGGGGTTGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 360
Summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 327}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181579861_1181579872 -6 Left 1181579861 22:23822206-23822228 CCCAAGTCGGCTTTGCCCAGTTC 0: 1
1: 0
2: 0
3: 2
4: 69
Right 1181579872 22:23822223-23822245 CAGTTCCAGCAGGGGTTGGGGGG 0: 1
1: 0
2: 2
3: 30
4: 327
1181579858_1181579872 7 Left 1181579858 22:23822193-23822215 CCAGGGCACCTGGCCCAAGTCGG No data
Right 1181579872 22:23822223-23822245 CAGTTCCAGCAGGGGTTGGGGGG 0: 1
1: 0
2: 2
3: 30
4: 327
1181579854_1181579872 21 Left 1181579854 22:23822179-23822201 CCTGGCTGCCCTTGCCAGGGCAC 0: 1
1: 0
2: 3
3: 30
4: 389
Right 1181579872 22:23822223-23822245 CAGTTCCAGCAGGGGTTGGGGGG 0: 1
1: 0
2: 2
3: 30
4: 327
1181579856_1181579872 13 Left 1181579856 22:23822187-23822209 CCCTTGCCAGGGCACCTGGCCCA 0: 1
1: 0
2: 3
3: 26
4: 361
Right 1181579872 22:23822223-23822245 CAGTTCCAGCAGGGGTTGGGGGG 0: 1
1: 0
2: 2
3: 30
4: 327
1181579860_1181579872 -1 Left 1181579860 22:23822201-23822223 CCTGGCCCAAGTCGGCTTTGCCC 0: 1
1: 0
2: 0
3: 7
4: 120
Right 1181579872 22:23822223-23822245 CAGTTCCAGCAGGGGTTGGGGGG 0: 1
1: 0
2: 2
3: 30
4: 327
1181579851_1181579872 26 Left 1181579851 22:23822174-23822196 CCAGGCCTGGCTGCCCTTGCCAG No data
Right 1181579872 22:23822223-23822245 CAGTTCCAGCAGGGGTTGGGGGG 0: 1
1: 0
2: 2
3: 30
4: 327
1181579857_1181579872 12 Left 1181579857 22:23822188-23822210 CCTTGCCAGGGCACCTGGCCCAA 0: 1
1: 0
2: 1
3: 34
4: 305
Right 1181579872 22:23822223-23822245 CAGTTCCAGCAGGGGTTGGGGGG 0: 1
1: 0
2: 2
3: 30
4: 327
1181579862_1181579872 -7 Left 1181579862 22:23822207-23822229 CCAAGTCGGCTTTGCCCAGTTCC 0: 1
1: 0
2: 0
3: 9
4: 135
Right 1181579872 22:23822223-23822245 CAGTTCCAGCAGGGGTTGGGGGG 0: 1
1: 0
2: 2
3: 30
4: 327
1181579850_1181579872 27 Left 1181579850 22:23822173-23822195 CCCAGGCCTGGCTGCCCTTGCCA 0: 1
1: 0
2: 2
3: 61
4: 520
Right 1181579872 22:23822223-23822245 CAGTTCCAGCAGGGGTTGGGGGG 0: 1
1: 0
2: 2
3: 30
4: 327

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181579872 Original CRISPR CAGTTCCAGCAGGGGTTGGG GGG Intronic
900149873 1:1173694-1173716 CAGTCCCAGCAGTGACTGGGAGG + Intergenic
900289355 1:1917312-1917334 CTGTCCCAGCCTGGGTTGGGGGG + Intergenic
900703207 1:4060710-4060732 AAGTGCGAGCAGGAGTTGGGGGG + Intergenic
901171872 1:7265004-7265026 CAGGGCCTGCAGGGGTGGGGAGG + Intronic
901404506 1:9037432-9037454 CAGTTCCCACTGGGGTGGGGAGG + Exonic
902379458 1:16045763-16045785 CAGGTGCAGCGGAGGTTGGGGGG + Intronic
902642188 1:17774171-17774193 TAGCTCCAGCAGGGGCTTGGGGG + Intronic
902895588 1:19477631-19477653 CAGTTGCAGCAGTGATTGGCAGG - Intronic
903178704 1:21594932-21594954 CAGGGCCAGCAGGGGATAGGGGG + Intergenic
903260883 1:22131366-22131388 CAGTCCCAGTGGGGGTTGGTGGG + Intronic
903403721 1:23078973-23078995 CACATCCTGCAGAGGTTGGGTGG - Exonic
903613452 1:24633911-24633933 CAATTCGGCCAGGGGTTGGGAGG + Intronic
905174706 1:36128117-36128139 CAGGTGGGGCAGGGGTTGGGGGG - Intergenic
905272114 1:36793969-36793991 CAGGTCCAGCAAGGAGTGGGGGG - Intergenic
906636821 1:47415851-47415873 CTGTTCCAGCTGGGGATGGAAGG + Intergenic
907285450 1:53376812-53376834 CATTTCCAGCAGCGGAGGGGTGG - Intergenic
908021312 1:59901379-59901401 CAGTTTCAGTAGGGCTTGGAAGG + Intronic
908085228 1:60625209-60625231 CCTTTCCAGAAAGGGTTGGGGGG + Intergenic
908131272 1:61077924-61077946 CGGTTCCAGAAAGGGGTGGGGGG + Intronic
910280472 1:85495037-85495059 CAGTTCCAGCAGAGGGCAGGCGG + Intronic
912094567 1:106121909-106121931 GTGTTCCAGCAGGGGTGGGGTGG - Intergenic
913017341 1:114752470-114752492 CACTTGGAGCAGGGGTTGGGGGG - Intronic
916395787 1:164386023-164386045 CAGGGCCTGCAGGGGGTGGGGGG - Intergenic
917665919 1:177225563-177225585 CAGTTCCACCAGAAGTTGTGAGG + Intronic
917791917 1:178504449-178504471 CAGTTCCAGCAGGAGCTCTGGGG - Intergenic
919132116 1:193464618-193464640 CAGTACCAGAAGGGGGTGGGAGG - Intergenic
920326466 1:205168860-205168882 CAGCTCCATTAGGGGTTGAGGGG + Intronic
922588829 1:226757112-226757134 AAGTTGCAGCAGGGTTTGAGAGG + Intergenic
922671789 1:227514082-227514104 CAGTTCCATCAGGGGATGATGGG + Intergenic
922819823 1:228476586-228476608 CAGTTCAAACAGGAGCTGGGAGG + Intergenic
923199073 1:231694343-231694365 GAGAGCCAGGAGGGGTTGGGGGG - Exonic
924375495 1:243403748-243403770 CAGTTCCATCAGGGGGTGACGGG - Intronic
1063953509 10:11245728-11245750 CAGGTCCTACAGGAGTTGGGGGG + Intronic
1064003303 10:11681332-11681354 CAATTCAAGCAGGGGTTGCAAGG - Intergenic
1065830394 10:29609350-29609372 CAGCACCAGCAGAGGGTGGGAGG - Intronic
1066964306 10:42247398-42247420 CAGTGCCAGCAGGAGTGGGATGG + Intergenic
1067440535 10:46306955-46306977 CTGTCCCAGCAGGGGGTGGGGGG - Intronic
1068543800 10:58325292-58325314 CAGTTACAGCTGGGGATGAGAGG + Intergenic
1069605310 10:69735306-69735328 CAGTTCCTGGTGGGGGTGGGGGG + Intergenic
1070783756 10:79151560-79151582 CAGCACCAGCTGGGCTTGGGAGG + Intronic
1072613446 10:97034446-97034468 GAGTCCCAGCAGGGCTGGGGTGG - Intronic
1073717812 10:106127909-106127931 CAAGTCCAGCAGGCATTGGGAGG + Intergenic
1074979543 10:118608615-118608637 CAGTGCCAGGAGAGGATGGGAGG + Intergenic
1075723887 10:124602025-124602047 CAGCTCCATCCGGGGGTGGGTGG + Intronic
1077026430 11:441941-441963 GAGTTCCAGCTGGGGTTTGGCGG + Exonic
1077104756 11:837340-837362 CAGCTGCAGCAGGAGGTGGGTGG + Exonic
1078148448 11:8738596-8738618 CAGTAGCAGCAGGGATGGGGAGG - Intronic
1079157877 11:17965311-17965333 CAGTTCCTGCATGGCTGGGGAGG - Intronic
1079362076 11:19777580-19777602 CAGTTCCTAAAGGGGATGGGGGG - Intronic
1079381283 11:19939821-19939843 CTGTTCCAGCAGGTATTGCGTGG - Intronic
1079408580 11:20165727-20165749 TAGTTCCAGCTTGGGGTGGGGGG - Intergenic
1080781132 11:35431027-35431049 CAGTTCCAGCAAGAGATGAGGGG + Intergenic
1081569505 11:44280859-44280881 GAGTTCCAGCAGAGGTTGAAGGG - Intronic
1081703892 11:45169024-45169046 CAGGTACAGCAGTGGTTGGGAGG + Intronic
1083491549 11:63017890-63017912 CACATCCATTAGGGGTTGGGGGG - Intergenic
1084456269 11:69269860-69269882 CAGGCCCACCAGAGGTTGGGAGG - Intergenic
1084534374 11:69748076-69748098 CAGCTGCAGCAGCGGGTGGGTGG - Intergenic
1084643939 11:70443393-70443415 CAGTTCCAACTGAGGTTTGGAGG + Intergenic
1084942410 11:72620066-72620088 GAGCTCCAGCAGAGGTGGGGTGG - Intronic
1087038038 11:93773666-93773688 CAGTTGCACCTGGGGTGGGGGGG + Intronic
1087215767 11:95491918-95491940 CAGTTCCAGGAGGCTTTTGGTGG + Intergenic
1088823007 11:113472638-113472660 CACTTCCAGCAGGGCATGAGTGG + Intronic
1089059170 11:115612191-115612213 CAGCTCCAGCAGGTCTTGGGGGG + Intergenic
1089305795 11:117525295-117525317 GATTCCCAGCAGGGGCTGGGAGG + Intronic
1089519473 11:119054347-119054369 CAGCTCCAACAGGGGCTGGGAGG + Intronic
1090397293 11:126427425-126427447 CAGCTCCGCCAGGGGTGGGGAGG + Intronic
1090525837 11:127535128-127535150 TAGTTCCAACAGGTTTTGGGGGG + Intergenic
1090905939 11:131074514-131074536 CAGCTCCAGGAGAGGTTGGTGGG + Intergenic
1091743512 12:2976606-2976628 CACTTCCTGCATGTGTTGGGTGG + Intronic
1092030041 12:5276381-5276403 CAGTTCCATAAGGTGTTGGGAGG + Intergenic
1092118943 12:6030386-6030408 CATTGACAGCAGGGGATGGGAGG - Intronic
1093528699 12:20135655-20135677 TAGTCCCAGCAGGGGGTGGCTGG + Intergenic
1095498221 12:42807870-42807892 CAGTAACAGCAGGGGATGGCAGG + Intergenic
1096802981 12:54123780-54123802 CTGTTTCAGCAGGAGTTGTGGGG - Intergenic
1097118849 12:56717788-56717810 GAGTTGCAGCTGGGGTTGTGGGG + Intronic
1097118875 12:56717857-56717879 GAGTTGCAGCTGGGGTTGTGGGG + Intronic
1097118900 12:56717926-56717948 GAGTTGCAGCTGGGGTTGTGGGG + Intronic
1097118924 12:56717995-56718017 GAGTTGCAGCTGGGGTTGTGGGG + Intronic
1097118948 12:56718064-56718086 GAGTTGCAGCTGGGGTTGTGGGG + Intronic
1097119048 12:56718340-56718362 GAGTTGCAGCTGGGGTTGTGGGG + Intronic
1097333865 12:58360449-58360471 CAGTTTCTGCATGGGTTGAGTGG + Intergenic
1100428116 12:94506419-94506441 CAGTTAGGGTAGGGGTTGGGTGG + Intergenic
1101531096 12:105574375-105574397 CAGTGCCTGCTGGGGTTGTGTGG + Intergenic
1102977617 12:117217873-117217895 CAGATCCAGCAGGTCTGGGGTGG + Intronic
1103906578 12:124330774-124330796 CAGCTGGAGCAGGGGTGGGGAGG + Intronic
1104079358 12:125416641-125416663 GAGTTCTAGCTGGGGTTGGCTGG - Intronic
1104324849 12:127786248-127786270 CAGCCCCAGCTGGGGTAGGGTGG - Intergenic
1104814322 12:131637231-131637253 CAGTGCCAGGAGGGGTGGGGAGG + Intergenic
1104958491 12:132477200-132477222 CAGCTGCAGCAGGGCTGGGGAGG - Intergenic
1107066581 13:36219925-36219947 CAGTTCCAGCATGGCTGGGGAGG - Intronic
1108800867 13:54092891-54092913 CAGAGCCGGCAGGGGTGGGGTGG + Intergenic
1110835518 13:80077754-80077776 CAGTTCCAGAAAGAGTGGGGAGG + Intergenic
1111721229 13:91947803-91947825 CTGTTGCTGCAGGGGTTGGGGGG - Intronic
1113990648 14:16024857-16024879 CAGCTCCTGGAGCGGTTGGGAGG + Intergenic
1115509612 14:34126724-34126746 CATTTCTATCAGGGGTTGTGAGG - Intronic
1116902162 14:50371801-50371823 CTGAGCCTGCAGGGGTTGGGGGG - Intronic
1118731217 14:68668232-68668254 CTGTGCCAGCAGGGGATGGTGGG + Intronic
1118839663 14:69500978-69501000 CAGATCCAGGATGGGGTGGGCGG + Intronic
1119199615 14:72742870-72742892 CAGCTCGAGCAGGGGTGGTGAGG - Intronic
1121744599 14:96278405-96278427 AGGTTCCAGCAGGAGATGGGAGG + Intergenic
1122129279 14:99595771-99595793 AAGTTACAGCAGGGGCAGGGTGG - Intronic
1122141837 14:99667383-99667405 CCCTGGCAGCAGGGGTTGGGAGG + Intronic
1122297469 14:100713516-100713538 CAGGTCCAGGAGGGGCTGGATGG + Intergenic
1202833181 14_GL000009v2_random:58297-58319 CAGTACCACCATGGGTGGGGAGG + Intergenic
1124624552 15:31300510-31300532 CAGGCCCTGGAGGGGTTGGGCGG - Intergenic
1125319878 15:38474695-38474717 CAGTTGAAGAGGGGGTTGGGAGG + Intronic
1126200305 15:45978299-45978321 CAGTTCCAGCATAGGAAGGGTGG - Intergenic
1126287600 15:47031461-47031483 CAGTTCCAGCAGCCTTTTGGAGG - Intergenic
1128154646 15:65384998-65385020 CAGTTCCAGCAGGGGGCAGCAGG + Exonic
1128454577 15:67825434-67825456 CAGTGCAAGGAGGGGTGGGGAGG - Intronic
1129476911 15:75791818-75791840 CAGTCCCAGCAGGGCCTGGTGGG - Intergenic
1129948939 15:79568921-79568943 AAGCTGCAGCAGGGGTTGAGAGG + Intergenic
1132233244 15:100200374-100200396 CAGCCACAGCAGGGGTGGGGAGG + Intronic
1132686242 16:1163303-1163325 CAGTTGGAGCAGGGCCTGGGAGG + Intronic
1132933783 16:2471278-2471300 CTGTGCCAGGAGGGGGTGGGGGG - Intergenic
1132996793 16:2827686-2827708 AAGCACCAGCTGGGGTTGGGGGG - Intergenic
1133237253 16:4393032-4393054 CTCTTCCAGCAGGGCTGGGGCGG - Intronic
1133801576 16:9090216-9090238 CAGATCCTGCAGGGGTTTGCAGG + Intergenic
1134282176 16:12826863-12826885 CAGTTCCAACATGGCTAGGGAGG - Intergenic
1135289802 16:21225517-21225539 CAGTTCCAACATGGCTGGGGAGG - Intergenic
1135809398 16:25573955-25573977 CAGTTCCCACAGGGTTTGGCTGG + Intergenic
1135884721 16:26295544-26295566 CAGTTGAAGGAGGGGTAGGGTGG + Intergenic
1135973654 16:27090379-27090401 CTATTCCAGTAGGGGATGGGAGG - Intergenic
1136301068 16:29334582-29334604 CAGTTCCAGGAGGGCCTTGGTGG + Intergenic
1136513115 16:30751317-30751339 CAGGGCCAGCAGGAGGTGGGGGG - Intronic
1138646252 16:58427189-58427211 CAGTTCCTGCAGGGGACGGAGGG + Intergenic
1139049388 16:63104689-63104711 CAGTTACAGCAAGGGTTGTAAGG - Intergenic
1139952070 16:70677397-70677419 CAGTGGCAGCAGGGCTGGGGTGG + Intronic
1140451570 16:75075083-75075105 CACTTCCAGGTGGGGGTGGGTGG + Intronic
1140489139 16:75319432-75319454 AAGTTACATCTGGGGTTGGGGGG + Intronic
1142062770 16:88041319-88041341 CAGTTCCAGGAGGGCCTTGGTGG + Intronic
1143019658 17:3910583-3910605 CAGCTCTGGCATGGGTTGGGAGG + Intronic
1144193376 17:12867190-12867212 CAGTTCCAGCAGGATTATGGGGG + Intronic
1147305537 17:39561671-39561693 CAGCTCCAGCAGGAGGTGGGAGG - Intronic
1147758196 17:42781828-42781850 CTGCTCCAGAAGGGGTTAGGGGG - Intronic
1149648901 17:58263899-58263921 CAGCACCAGCAGGGATTGAGTGG - Intronic
1150840632 17:68602226-68602248 CAATTCCAGCAAGGGAAGGGAGG - Intergenic
1151338872 17:73456997-73457019 CTGATCCAGCAGGTCTTGGGGGG - Intronic
1151621740 17:75249794-75249816 CAGTTGCTTCGGGGGTTGGGGGG - Intronic
1153225220 18:2894611-2894633 CTGTTGCAGTAGGAGTTGGGGGG + Intronic
1153486712 18:5605828-5605850 GAGTACCAGGAGGGGTTCGGAGG + Intronic
1154406945 18:14101151-14101173 CAGGTCCAGGAGCTGTTGGGTGG + Intronic
1155446168 18:25915187-25915209 CAGTTCCCACAGGGCTGGGGAGG + Intergenic
1156199370 18:34812700-34812722 CAGTTCAAGATGGGATTGGGTGG + Intronic
1156577426 18:38334270-38334292 CAGTTTCCGCAGGGGTGTGGAGG - Intergenic
1157342491 18:46791786-46791808 GAGGTTCTGCAGGGGTTGGGAGG - Intergenic
1158437599 18:57444409-57444431 GAGTTCCAGCAGGATCTGGGTGG + Intronic
1158632936 18:59132059-59132081 CTGAGCCTGCAGGGGTTGGGGGG - Intergenic
1158800167 18:60896973-60896995 CAGTGTAAGGAGGGGTTGGGGGG - Intergenic
1159517556 18:69476785-69476807 AAGTTCCAGCAAGAGATGGGAGG - Intronic
1161198845 19:3003028-3003050 CAGCACCATCAGGGGTTGCGGGG + Intronic
1161673016 19:5624577-5624599 CACTGCCTGCAGGGGCTGGGGGG - Intronic
1162028715 19:7908351-7908373 CAGCTCCTGCAGGGGCTGGCAGG + Intronic
1162028891 19:7909050-7909072 CAGCTCCTGCAGGGGCTGGCGGG - Intronic
1162449835 19:10748079-10748101 CAGGTCGTGCAGGGCTTGGGGGG + Intronic
1162860321 19:13501614-13501636 CTGGTCCAGCAGGATTTGGGTGG - Intronic
1165017347 19:32890729-32890751 CAGGGCCTGCAGGGGTTGAGGGG - Intronic
1165290512 19:34880604-34880626 CAGTTCCAACATGGCTGGGGAGG - Intergenic
1165896149 19:39142501-39142523 CAGATCCAGCAGAAGTAGGGTGG + Intronic
1165931905 19:39364691-39364713 CAGTGCCAGGTGGAGTTGGGAGG + Intronic
1166054661 19:40281118-40281140 AAGTGCCTGCAGGGGTTGGCAGG - Intronic
1166140539 19:40802980-40803002 AAGTTCCAGCTGGGGTGGGGAGG - Intronic
1167272279 19:48512042-48512064 CACTTGCAGCGGGGGTGGGGGGG + Intronic
1167762293 19:51457416-51457438 CAGGTCCCTCATGGGTTGGGAGG - Intronic
1168237976 19:55075729-55075751 CAGATCTAGGAGGGGCTGGGGGG - Intronic
1168588681 19:57614955-57614977 CAGTGGCAGGAGGGGTTGGGTGG + Intronic
925848641 2:8058045-8058067 CACTTCCATCAGAGGTTGGATGG + Intergenic
926918402 2:17915455-17915477 AAGGTCAAGCAGGGATTGGGGGG - Intronic
927719039 2:25371620-25371642 CACTTCCAGCAGGGGTCTGGGGG - Intergenic
927851012 2:26499355-26499377 CAGATCCAGGAAGGGTTGTGAGG - Intronic
929805134 2:45138441-45138463 CATTTCCAGCCGGGGGTGGTGGG - Intergenic
932655416 2:73607417-73607439 CTGTTCTAGCAGGGGTTGGGTGG - Intronic
932703771 2:74008135-74008157 CATGTCCAGAAGGGGTGGGGAGG - Intronic
933785272 2:85835464-85835486 CAGTTCCAACAGTTGTTTGGTGG - Intergenic
935087041 2:99858202-99858224 CAGTTCCAGCCTGGGCTGGCAGG + Intronic
936093601 2:109515956-109515978 CATTTCCACCTGGGGTTGGAGGG + Intergenic
936269992 2:111042039-111042061 CAGTTCCCAAAGGGGCTGGGGGG - Intronic
936614987 2:114039469-114039491 CACTTACAGCAGCAGTTGGGAGG - Intergenic
936833522 2:116678911-116678933 CAGCTCCAGCAGTTGTTGTGAGG + Intergenic
937261013 2:120586880-120586902 CAGCCCCAGCAGGGGGTAGGAGG + Intergenic
937498620 2:122452262-122452284 CAGTTCCAGCAGTCTTTGGGTGG - Intergenic
938804596 2:134794495-134794517 CTGTTCCAACAGAGGCTGGGAGG + Intergenic
940810140 2:158233664-158233686 CAGTTCATGCAGGGGTTTGGAGG + Intronic
942764731 2:179441392-179441414 GAATTCCAGCAGGGTTTGGCCGG - Intergenic
943661695 2:190565995-190566017 CATATCCAGTAAGGGTTGGGGGG - Intergenic
943672512 2:190678665-190678687 CAGTTCCAGCAAGGTGGGGGTGG + Intronic
944817776 2:203396777-203396799 CAGAGCCAGCAGGGGCTGAGGGG - Exonic
948880065 2:240852161-240852183 CAGTGCCAGCTGGGGCTGGGAGG - Intergenic
1168972021 20:1937651-1937673 CAGTTCCCGGAGGGCTGGGGCGG + Exonic
1170007624 20:11686435-11686457 GAATTCCAGCTGGGGCTGGGAGG + Intergenic
1170919954 20:20668686-20668708 CACTTCCAGCAGGAGTTGCCAGG + Intronic
1171201046 20:23242437-23242459 CAGTTGCAGCAGAGACTGGGTGG - Intergenic
1171251725 20:23653932-23653954 CAGCTCAAGCAGGGCTTGGTGGG - Intergenic
1171793774 20:29550808-29550830 CTGTTTCAGCAGGAGTTGTGGGG + Intergenic
1171813202 20:29762168-29762190 CGGCTCCTGGAGGGGTTGGGAGG - Intergenic
1172038832 20:32029634-32029656 CCTTTCAGGCAGGGGTTGGGTGG + Intronic
1172087398 20:32397651-32397673 CAATTCCAGCAGCATTTGGGAGG - Intronic
1172346856 20:34208989-34209011 CAGTTCCAATAGGGTTTTGGTGG + Intronic
1173262259 20:41447011-41447033 AATTTCCAGCAGGGATGGGGAGG - Intronic
1173882007 20:46422476-46422498 CGGTTCCAGAAGAGGTTGCGAGG + Intronic
1174883411 20:54305308-54305330 CAGGTCCTTCTGGGGTTGGGAGG + Intergenic
1175061752 20:56249648-56249670 CAGATGCAGTAGGGGTTGGTGGG - Exonic
1175757667 20:61539737-61539759 CTGTGACAGCAGGGCTTGGGGGG - Intronic
1175822450 20:61917656-61917678 CAGCTCCAGCACCGGCTGGGCGG - Intronic
1175870512 20:62207369-62207391 CAGTCCCAGGAGGGCTGGGGTGG - Intergenic
1175904891 20:62374924-62374946 CAGGTCCAGCTGGTGTTGGCAGG - Intergenic
1175950592 20:62581282-62581304 CAGTCCCAGCATGGGGTGGGGGG - Intergenic
1175950626 20:62581394-62581416 CAGTCCCAGCGTGGGGTGGGGGG - Intergenic
1175975248 20:62707678-62707700 CAGTGCCACCAGGTGCTGGGGGG + Intergenic
1176040928 20:63065463-63065485 CACTTCCTGCGGGGGGTGGGGGG - Intergenic
1176425826 21:6547634-6547656 CACAGGCAGCAGGGGTTGGGGGG + Intergenic
1178567169 21:33698328-33698350 GAGTGGCAGCAGGGGATGGGAGG - Intronic
1178902072 21:36606079-36606101 CAGAGCCAGGAGGGGCTGGGTGG + Intergenic
1179130880 21:38636212-38636234 CAGTTCCAACATGGCTGGGGAGG - Intronic
1179445496 21:41427367-41427389 AAATACCAGCAGGGTTTGGGGGG + Intronic
1179622926 21:42630737-42630759 CAGTGCCAGCAGAGGTGCGGAGG + Intergenic
1179701317 21:43155951-43155973 CACAGGCAGCAGGGGTTGGGGGG + Intergenic
1180232632 21:46436476-46436498 CAGTGCCAGCGGGGGGGGGGGGG - Intronic
1180316622 22:11282669-11282691 CAGCTCCTGGAGCGGTTGGGAGG - Intergenic
1180338711 22:11600826-11600848 CAGCTCCTGGAGCGGTTGGGAGG + Intergenic
1181327512 22:22061172-22061194 CAGTTCTGGCATGAGTTGGGAGG - Intergenic
1181537832 22:23555954-23555976 TACTTTCAGCAGGGGGTGGGGGG - Intergenic
1181579872 22:23822223-23822245 CAGTTCCAGCAGGGGTTGGGGGG + Intronic
1181691400 22:24563746-24563768 CAGTCCCATCAGTGATTGGGTGG - Intronic
1182395995 22:30036356-30036378 CAGTCCCAGGAAGGGTTGGTGGG - Intergenic
1182470280 22:30544166-30544188 CAGTTCCCGGAGGGCTGGGGCGG + Intronic
1182827640 22:33279493-33279515 CAGTTCCCTGAGGGTTTGGGGGG - Intronic
1183066784 22:35368874-35368896 CAGTTACAGGAGGAGGTGGGAGG - Intergenic
1183090978 22:35521730-35521752 TCGGGCCAGCAGGGGTTGGGTGG + Intergenic
1183313318 22:37123533-37123555 GAGTTCACGCTGGGGTTGGGGGG - Intergenic
1183314293 22:37128519-37128541 CAGAGGCTGCAGGGGTTGGGGGG + Exonic
1183332780 22:37230248-37230270 CAGTTCCGGCAGGGGGAGGTGGG + Intronic
1183426075 22:37740131-37740153 CAGGTCCAGGAGGGCTTTGGGGG - Intronic
1183596818 22:38817899-38817921 CAGGTGCTGCAGGGGTGGGGTGG + Intergenic
1184170855 22:42759013-42759035 CAGTTTGAGGAGGGGTGGGGAGG - Intergenic
1184994168 22:48192570-48192592 CAGTTCCAACAGGTTTTGGTTGG + Intergenic
1185007527 22:48290845-48290867 CTGATTCAGCAGGTGTTGGGTGG - Intergenic
1185336387 22:50272449-50272471 CAGGACCAGCGGGGGTGGGGTGG - Intergenic
1185412852 22:50695064-50695086 CAGGCCCTGGAGGGGTTGGGAGG + Intergenic
949874656 3:8618364-8618386 CAGGAACAGCAGGGGTTAGGGGG - Intergenic
949950878 3:9227786-9227808 CATTCCCCTCAGGGGTTGGGGGG + Intronic
950896862 3:16460568-16460590 CATTTCAAGCAGAGGCTGGGTGG + Intronic
951596188 3:24320783-24320805 AAATGCCAGCAAGGGTTGGGTGG - Intronic
951993771 3:28704399-28704421 TAGTTGCAGCAGGGGTTGAGGGG + Intergenic
952276504 3:31882449-31882471 CTGATTCAGCAGGGCTTGGGTGG - Intronic
953246423 3:41198843-41198865 CAGGTCCAGCAGGGAGTGTGCGG + Intronic
953368765 3:42369755-42369777 CAGATCATGCAGGGGTTGTGGGG - Intergenic
955060173 3:55486919-55486941 AACTTCCAACAGGGGGTGGGGGG + Intronic
958098895 3:88983514-88983536 CATTTCTAGCAGTGGTGGGGAGG - Intergenic
960471374 3:118070065-118070087 CAGTTCTAGCAGTGTTTTGGTGG + Intergenic
960870103 3:122239468-122239490 GAGTTCCCCCAGGCGTTGGGTGG - Intronic
960971942 3:123145999-123146021 CAGGTCCAGGATGGGTTGTGGGG + Intronic
961650011 3:128412644-128412666 GAGGTGCAGCAGGGGCTGGGGGG - Intergenic
962458020 3:135583108-135583130 CAGTGACAGCAGAGGCTGGGTGG - Intergenic
964205880 3:154174499-154174521 CAAATTCAGCAGGGGTTGGAGGG + Intronic
965778870 3:172262242-172262264 CATTTCCCAGAGGGGTTGGGTGG + Intronic
966289146 3:178334475-178334497 CGGTGGTAGCAGGGGTTGGGGGG + Intergenic
967516346 3:190373224-190373246 CTGTTTCAGCAGGGGTTGCAGGG + Intronic
968715615 4:2157058-2157080 CAGTTCCTACATGGGTTAGGGGG - Intronic
969112876 4:4854660-4854682 CAGTTCCGGCAGGGGGTGGGAGG - Intergenic
969282609 4:6181270-6181292 CAGTTCCAGAAAGGGTGGAGGGG + Intronic
969366323 4:6696488-6696510 CAGTGCCAGCACGAGATGGGAGG + Intronic
970493342 4:16598964-16598986 CTGTTCCAGCATGGGCAGGGTGG + Intronic
971372381 4:26029174-26029196 CCGTTCCACCAGGGGTGGGTGGG - Intergenic
973763327 4:54140442-54140464 TAGTTACAGCAGGCCTTGGGTGG + Intronic
974027737 4:56748756-56748778 CTGCTCCAGCAAGGGTTGGGAGG + Intergenic
974572446 4:63670274-63670296 TAGTCCCAGCAGGGGTTGGCTGG + Intergenic
975690439 4:76957659-76957681 CAGTTCCCACTGGGGTGGGGTGG - Intronic
981582549 4:146264654-146264676 CAGTTGCAGCAGGAGTTGTGAGG - Intronic
982040702 4:151393230-151393252 CAGTTCCAGCAGCCTTTTGGTGG - Intergenic
982350271 4:154407724-154407746 AAGTTCCTGCAGGGTCTGGGAGG + Intronic
982516474 4:156357040-156357062 CAGTTCCAGGAGGCTTTTGGTGG + Intergenic
982685275 4:158481205-158481227 GAGTTACAGCAGAGGTTTGGAGG - Intronic
983388783 4:167102348-167102370 CTGTTCCTGCAGGGGAAGGGAGG - Intronic
985520400 5:371519-371541 CAGGTGCAGCAGGGGCTGGCAGG + Intronic
986822266 5:11480915-11480937 AAGCTCCAGCAGGGCTTGGCAGG - Intronic
989403503 5:41034710-41034732 CAGTTCCAGCAGGCTTTTGGTGG - Intronic
989777546 5:45226820-45226842 CAGTTTCAACTGGGTTTGGGTGG + Intergenic
993618175 5:90137461-90137483 CAGTTACAGCAGGGGAGGCGTGG - Intergenic
995030283 5:107472996-107473018 GAGTTCAAGCAGGTGCTGGGGGG - Intronic
996864905 5:128109526-128109548 CAGTTCCAGCACTTGCTGGGTGG + Intronic
997195321 5:131975377-131975399 CAGGTCCTGCAGGTGTGGGGAGG - Intronic
999216179 5:149937322-149937344 CAGATCCAGCAGGGCTTTGGAGG + Intronic
999312204 5:150558701-150558723 CAGCTCCAGCAGATGTGGGGTGG + Intergenic
999428307 5:151505755-151505777 CAGTTCCGGCAGGGAGGGGGAGG - Exonic
1000104119 5:158042566-158042588 CATTTCCAGTAGTGGATGGGTGG + Intergenic
1001598146 5:172911465-172911487 CAGATCCAGCAGGGCATGGCAGG - Intronic
1001903279 5:175448925-175448947 CAGTTTCTGCAGTGGTTGGTGGG + Intergenic
1002099328 5:176849654-176849676 CAGTGCCTTCAGGGGCTGGGTGG - Intronic
1002135512 5:177105396-177105418 CAGTGAGAGCAGGGGGTGGGGGG - Intergenic
1002429393 5:179194309-179194331 ATGTTCCAGCAGGGCTGGGGAGG - Intronic
1002470580 5:179432890-179432912 CAGTCCCAGCAGAGGCTGGAGGG - Intergenic
1002637002 5:180613499-180613521 GAGGAGCAGCAGGGGTTGGGGGG - Intronic
1002658802 5:180775849-180775871 CAGGTGCAGCAGGGGTTTGGAGG + Intergenic
1002704594 5:181151709-181151731 CAGTTGAAGCTGGGGCTGGGAGG + Intergenic
1003134093 6:3419562-3419584 CAGCTCTGGCAAGGGTTGGGTGG + Intronic
1003141344 6:3473969-3473991 CTGCTCCAGAAGGGATTGGGTGG + Intergenic
1006836904 6:37004512-37004534 CAGTTCCAGCAAAGGTTCGTTGG - Intergenic
1007630544 6:43270741-43270763 CAGTTCCAGCCTGCCTTGGGAGG - Intronic
1009656851 6:66558486-66558508 CAGCTCCAGCTGGGGGTTGGAGG + Intergenic
1009684355 6:66936947-66936969 CAGTGCCAGCAGAGGGTGGCAGG - Intergenic
1010793632 6:80093485-80093507 CAATTCCAAGATGGGTTGGGAGG + Intergenic
1014280326 6:119435638-119435660 CAGTTACAGAAGTGCTTGGGAGG + Intergenic
1016363896 6:143295278-143295300 CAGTTCTAGCAGTGGTTGAGAGG - Intronic
1017042355 6:150317602-150317624 CAGTTGCCCCAGGGGGTGGGGGG + Intergenic
1018554590 6:165036499-165036521 AATTTGCTGCAGGGGTTGGGGGG + Intergenic
1018987286 6:168647452-168647474 GAGTTACAGCAAGGGTTGGCAGG + Intronic
1019284505 7:216812-216834 CAGTTGCAGAAGGGCTTGCGGGG + Intronic
1019377307 7:699679-699701 CAGCTGCAGGAGGGGTGGGGAGG + Intronic
1019591937 7:1839942-1839964 GTCTTCCAGCAGGGATTGGGGGG - Intronic
1020550392 7:9596744-9596766 TAGTTCCAGCAGTGGTTAGAAGG + Intergenic
1021554983 7:21909950-21909972 CAGTTCCCACAGGGGTGGGCAGG + Intronic
1024405359 7:48973033-48973055 CAGTTCCAGAAGGCTTTTGGTGG - Intergenic
1025982553 7:66418716-66418738 CAGTGTCAGTAGAGGTTGGGTGG - Intronic
1027254783 7:76424219-76424241 CAGGGCCAGCAGGGGATCGGAGG + Intronic
1027787832 7:82602425-82602447 CAGTTCCATCTGGGGTTGACGGG - Intergenic
1032081379 7:128860138-128860160 CTGATCCAGGAGGGGTAGGGAGG - Intergenic
1033596397 7:142862644-142862666 CAGGTCCATCGGGGGTGGGGCGG + Intronic
1034291749 7:149937935-149937957 CAGTCCCAGCGGGGAATGGGAGG + Intergenic
1034448565 7:151125745-151125767 CACTCCCAGCAGGAGCTGGGGGG - Intronic
1034814336 7:154158963-154158985 CAGTCCCAGCGGGGAATGGGAGG - Intronic
1034987868 7:155528525-155528547 CAAGTCCAGCAGAGGGTGGGTGG + Intronic
1035062022 7:156076354-156076376 CAGTGCCAGCACAGGTTGGGGGG + Intergenic
1035288099 7:157819100-157819122 CAGGCCCAGCAGGTGTTTGGGGG - Intronic
1035467310 7:159088049-159088071 CAGTGCCTTCAGGGGTCGGGTGG - Intronic
1036086408 8:5617610-5617632 CAGTGCCAGCAGGACTTGGAAGG - Intergenic
1038396248 8:27247654-27247676 CAGTTCCAGGAGAGGTTTGGTGG - Intronic
1040746044 8:50643751-50643773 CAGTAACAGCAGGGCTGGGGAGG + Intronic
1041455666 8:58056828-58056850 CTGTTACAGCAGGGGTGGGATGG - Intronic
1045452199 8:102338555-102338577 CAGTTCCTGCAGGTCATGGGAGG - Intronic
1046066171 8:109199292-109199314 GAGTTCAAGCAGTGGTTGGCTGG + Intergenic
1046195593 8:110859953-110859975 CAGTTGCAGCAGGGGAGGTGTGG + Intergenic
1046335186 8:112776926-112776948 CTTTTACAGCAGAGGTTGGGAGG - Intronic
1047303296 8:123633579-123633601 CAATCCTAGCAGGGGTGGGGAGG - Intergenic
1047691069 8:127355162-127355184 CAATCCCAGCATGGGGTGGGTGG + Intergenic
1049128173 8:140810961-140810983 CAGTAGCAGCACGGTTTGGGTGG - Intronic
1049252948 8:141598890-141598912 CAGCTCCAGCTGTGGTTGTGTGG + Intergenic
1049499380 8:142953433-142953455 CAGAGGCAGCAGGGGTGGGGAGG - Intergenic
1050313944 9:4381948-4381970 CAGTCCCAGCACAGGCTGGGTGG + Intergenic
1051941641 9:22513222-22513244 GAATGCCTGCAGGGGTTGGGAGG + Intergenic
1052781891 9:32790175-32790197 AAGCTCCCGCAGGGGATGGGAGG - Intergenic
1053466466 9:38312143-38312165 CTGAACCAGCAGGGGCTGGGAGG + Intergenic
1053850992 9:42288862-42288884 CCTTTCCAGGAGGGGTTGGTGGG - Intergenic
1053897142 9:42753694-42753716 CAGAGCCAGCAGGGGGTGGCAGG + Intergenic
1054152655 9:61617957-61617979 CTGTTTCAGCAGGAGTTGTGGGG + Intergenic
1055270697 9:74554906-74554928 CAGTTACCCCAGTGGTTGGGTGG + Intronic
1057929756 9:99183644-99183666 CCGTTGCAGCAGTGGTTGAGTGG + Intergenic
1059346250 9:113630972-113630994 CAACTCCAGGAAGGGTTGGGGGG - Intergenic
1061306675 9:129736471-129736493 CAGCTCCAGCCTGGGGTGGGCGG - Intergenic
1061661340 9:132132314-132132336 CAGTTTCAGGAGGGGCAGGGAGG + Intergenic
1062101673 9:134731682-134731704 CCGTTCCGGGTGGGGTTGGGGGG + Intronic
1062391643 9:136336279-136336301 CAGTGTCAGCATGGGCTGGGGGG - Intronic
1203364929 Un_KI270442v1:248621-248643 CAGCTCCTGGAGCGGTTGGGAGG - Intergenic
1190417926 X:50199519-50199541 TAGTTCCAGACTGGGTTGGGAGG - Intronic
1192172928 X:68867940-68867962 CAGTGACAGCAGGGAGTGGGAGG - Intergenic
1192554331 X:72077931-72077953 CAGCTCCAGCAGGGCTTCTGTGG + Intergenic
1193091680 X:77500544-77500566 CAGGGCCTGTAGGGGTTGGGGGG + Intergenic
1200052617 X:153443012-153443034 CAGTGGCAGCAGGGGAGGGGAGG - Intergenic
1201762959 Y:17558717-17558739 TCCTTCCAGCAGGGGTAGGGTGG - Intergenic
1201838593 Y:18347272-18347294 TCCTTCCAGCAGGGGTAGGGTGG + Intergenic