ID: 1181580830

View in Genome Browser
Species Human (GRCh38)
Location 22:23827253-23827275
Sequence GCTGCCAGTGCCCACAGTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 291
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 268}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181580817_1181580830 27 Left 1181580817 22:23827203-23827225 CCCCCAGCATCCAGCCCCTACGG 0: 1
1: 0
2: 1
3: 10
4: 182
Right 1181580830 22:23827253-23827275 GCTGCCAGTGCCCACAGTCCAGG 0: 1
1: 0
2: 2
3: 20
4: 268
1181580823_1181580830 13 Left 1181580823 22:23827217-23827239 CCCCTACGGTGTTGACCTTCACC 0: 1
1: 0
2: 0
3: 5
4: 40
Right 1181580830 22:23827253-23827275 GCTGCCAGTGCCCACAGTCCAGG 0: 1
1: 0
2: 2
3: 20
4: 268
1181580825_1181580830 11 Left 1181580825 22:23827219-23827241 CCTACGGTGTTGACCTTCACCTA 0: 1
1: 0
2: 1
3: 4
4: 36
Right 1181580830 22:23827253-23827275 GCTGCCAGTGCCCACAGTCCAGG 0: 1
1: 0
2: 2
3: 20
4: 268
1181580824_1181580830 12 Left 1181580824 22:23827218-23827240 CCCTACGGTGTTGACCTTCACCT 0: 1
1: 0
2: 0
3: 2
4: 45
Right 1181580830 22:23827253-23827275 GCTGCCAGTGCCCACAGTCCAGG 0: 1
1: 0
2: 2
3: 20
4: 268
1181580820_1181580830 25 Left 1181580820 22:23827205-23827227 CCCAGCATCCAGCCCCTACGGTG 0: 1
1: 0
2: 0
3: 5
4: 84
Right 1181580830 22:23827253-23827275 GCTGCCAGTGCCCACAGTCCAGG 0: 1
1: 0
2: 2
3: 20
4: 268
1181580826_1181580830 -2 Left 1181580826 22:23827232-23827254 CCTTCACCTAGTCCTGCAGCCGC 0: 1
1: 0
2: 3
3: 21
4: 268
Right 1181580830 22:23827253-23827275 GCTGCCAGTGCCCACAGTCCAGG 0: 1
1: 0
2: 2
3: 20
4: 268
1181580821_1181580830 24 Left 1181580821 22:23827206-23827228 CCAGCATCCAGCCCCTACGGTGT 0: 1
1: 0
2: 0
3: 11
4: 101
Right 1181580830 22:23827253-23827275 GCTGCCAGTGCCCACAGTCCAGG 0: 1
1: 0
2: 2
3: 20
4: 268
1181580819_1181580830 26 Left 1181580819 22:23827204-23827226 CCCCAGCATCCAGCCCCTACGGT 0: 1
1: 0
2: 0
3: 21
4: 221
Right 1181580830 22:23827253-23827275 GCTGCCAGTGCCCACAGTCCAGG 0: 1
1: 0
2: 2
3: 20
4: 268
1181580822_1181580830 17 Left 1181580822 22:23827213-23827235 CCAGCCCCTACGGTGTTGACCTT 0: 1
1: 0
2: 0
3: 6
4: 87
Right 1181580830 22:23827253-23827275 GCTGCCAGTGCCCACAGTCCAGG 0: 1
1: 0
2: 2
3: 20
4: 268
1181580827_1181580830 -8 Left 1181580827 22:23827238-23827260 CCTAGTCCTGCAGCCGCTGCCAG 0: 1
1: 1
2: 5
3: 31
4: 395
Right 1181580830 22:23827253-23827275 GCTGCCAGTGCCCACAGTCCAGG 0: 1
1: 0
2: 2
3: 20
4: 268

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181580830 Original CRISPR GCTGCCAGTGCCCACAGTCC AGG Intronic
900403221 1:2481340-2481362 CCTGCCAGCCCCCACAGCCCAGG - Intronic
900515048 1:3077738-3077760 GCTGCAGGTGCTCACAGGCCAGG + Intronic
901229480 1:7633935-7633957 GCAGCCAGAGACCACAGCCCAGG + Intronic
902053699 1:13583631-13583653 TTTGCCAGGGCCCGCAGTCCTGG + Exonic
902876538 1:19343923-19343945 GCAGGCAGGGCCCTCAGTCCGGG - Intronic
904049698 1:27631827-27631849 CCTGCCCCTGCCCAAAGTCCCGG - Intronic
905176293 1:36137570-36137592 GCTGTCAGTCCCCAAAGCCCAGG - Intronic
906159875 1:43640185-43640207 GCTGCTAGTGCCCACTGGCAAGG + Intergenic
906322073 1:44823131-44823153 GCTGACAGTGCTCACGCTCCTGG - Exonic
906703339 1:47875860-47875882 GCTGGCTGTGGCCACAGCCCTGG + Intronic
909145239 1:71922077-71922099 ACTGCCAGAGCCCACAGGTCAGG + Intronic
910277359 1:85464242-85464264 GGTGTCGGTGCCCACAGACCTGG - Intronic
912379669 1:109240580-109240602 CCTGCCTGCGCTCACAGTCCAGG + Intergenic
915104045 1:153521620-153521642 GCTGGCAGTCCTCACAGCCCTGG + Intergenic
915497913 1:156294377-156294399 GCTGCCATTGGCAAAAGTCCTGG + Exonic
918128604 1:181605672-181605694 TCTGCCACTGCCCAGAGTCTGGG + Intronic
919940474 1:202282623-202282645 GCTAACAGCGCCCACACTCCAGG - Intronic
920197091 1:204235870-204235892 GCTGCCAGAGGCAACAGTCAAGG + Intronic
920386259 1:205571998-205572020 TCTGCCTGTGCCCTCAGTCTGGG - Intronic
920431926 1:205924205-205924227 CCAGACTGTGCCCACAGTCCTGG + Intronic
920884368 1:209912242-209912264 GCTTCCTGTGCCCACAGTTCTGG + Intergenic
922841839 1:228648446-228648468 ACGCCCAGGGCCCACAGTCCTGG + Intergenic
923930160 1:238685157-238685179 GCTGGCAGTCCTCACAGCCCTGG - Intergenic
1063175244 10:3544785-3544807 GCCTCCAGTGCCCACTGCCCTGG - Intergenic
1066235011 10:33477091-33477113 TCTGCCATTGGCCACGGTCCTGG - Intergenic
1066335059 10:34467984-34468006 GCTGCCAGTCATCACAGCCCAGG - Intronic
1068060773 10:52064677-52064699 GATGCCTGGGCCCACAGTCGTGG + Intronic
1069679282 10:70272419-70272441 GCTGCCAGTGAACCCAGGCCTGG + Intronic
1069869947 10:71527041-71527063 GCTGCAAGGTGCCACAGTCCAGG - Intronic
1069950365 10:72014489-72014511 TCTGCCAGTTCACCCAGTCCAGG + Intergenic
1070271315 10:74958565-74958587 GCTGACAGTGCCTACAGATCTGG - Intronic
1070305422 10:75236182-75236204 CCCGCCTGTGCCCGCAGTCCAGG + Intergenic
1070445746 10:76499911-76499933 CATGCCAGTGCCCTCAGTCTAGG - Intronic
1071595136 10:86916583-86916605 CCTCCCAGTGCACACAGTCGTGG - Intronic
1072617479 10:97059385-97059407 GCTGGCAGGGCCCAGGGTCCTGG - Intronic
1075686660 10:124369153-124369175 GCAGCCAGTGACCACATGCCTGG + Intergenic
1076055336 10:127367963-127367985 GCTGACAGTGGCCACAGGGCTGG - Intronic
1076340462 10:129741851-129741873 GGTGCCTGGGCCCACCGTCCAGG + Intronic
1076727136 10:132419219-132419241 GCTGCCAGTACCCACTGGTCAGG + Intergenic
1079306369 11:19327095-19327117 GTTGCCAGTGGCCACAGCACTGG - Intergenic
1079731833 11:23942804-23942826 GCTGGCAGTCCTCACAGCCCTGG - Intergenic
1083763188 11:64829789-64829811 GCTGCCAGGGCCCAGGGCCCGGG + Exonic
1083923445 11:65792492-65792514 GCTGTCTGTGCCCACAGGGCTGG - Intronic
1084268669 11:68017692-68017714 GCTGTCAGTTCCCACAGCCCAGG - Intronic
1084510105 11:69597927-69597949 GCTCCCAGTGCACAGAGGCCTGG - Intergenic
1084613266 11:70217719-70217741 GCTACAAGTGCCCACAGCCCAGG - Intergenic
1085109246 11:73873213-73873235 GCTGGCATTGCCGCCAGTCCTGG + Exonic
1086807937 11:91268590-91268612 GCTGGCAGTCCTCACAGCCCTGG + Intergenic
1088692782 11:112342085-112342107 GCTGCTAGTGCACACACTCCTGG + Intergenic
1090348316 11:126089160-126089182 GCTGAGGGTGCCCAAAGTCCAGG - Intergenic
1091656830 12:2352186-2352208 TCTGCCAAGGCCCACAGTGCAGG - Intronic
1092206502 12:6617686-6617708 GCTGCCAGTGCTCTCAGGACAGG + Intergenic
1093034410 12:14319928-14319950 GCTGGCAGTCCTCACAGCCCTGG + Intergenic
1093189317 12:16057216-16057238 GCTGGCAGTCCTCACAGCCCTGG + Intergenic
1093266195 12:17007458-17007480 GCTGGCAGTCCTCACAGCCCTGG + Intergenic
1096420846 12:51456112-51456134 ACTGACACTGCCCACAGTGCAGG - Intronic
1098168297 12:67719758-67719780 GCTGGCAGTCCTCACAGCCCTGG - Intergenic
1099420245 12:82449400-82449422 GCTGCCCATGCACACCGTCCTGG + Intronic
1100844656 12:98645555-98645577 GCAGCCTGACCCCACAGTCCCGG - Exonic
1103545000 12:121694135-121694157 ACTGCCAGAGCCCAGAATCCTGG - Intergenic
1104058787 12:125250497-125250519 GCTCACACTGCCCCCAGTCCAGG + Intronic
1104775166 12:131386439-131386461 GCTCCCAGAGCCCCCAGTGCAGG - Intergenic
1105587026 13:21755039-21755061 GTGCCCAGTGACCACAGTCCAGG + Intergenic
1109745736 13:66621782-66621804 GCTGGCAGTCCTCACAGCCCTGG + Intronic
1110615307 13:77535064-77535086 GCTTCCACCGCCCAAAGTCCTGG + Intergenic
1111531434 13:89542051-89542073 GCTGCCTCTGCCCACTCTCCAGG + Intergenic
1111542601 13:89688874-89688896 TCAGCCAGTGCCCACAGACAGGG + Intergenic
1112494800 13:99896141-99896163 GCGAGCAGGGCCCACAGTCCAGG - Exonic
1113929053 13:113956884-113956906 GGTGCCTGTGGCCACAGTGCTGG - Intergenic
1119789911 14:77341016-77341038 ACTGCCAGTGCCCATAGTAAGGG + Exonic
1121120389 14:91372402-91372424 GCTCCCAGTGCCCCCAGCTCAGG - Intronic
1121436811 14:93925965-93925987 CCTGCCAATGCCCCCAGTCTGGG + Intronic
1121636180 14:95455319-95455341 GCTGTCTGTGCCCAGGGTCCTGG - Intronic
1121644027 14:95505419-95505441 GTGGCTAGTGCCAACAGTCCTGG + Intergenic
1122347033 14:101067149-101067171 GCTGCCCATGCCCAGGGTCCAGG + Intergenic
1122422538 14:101586722-101586744 GCAGCCAGTGCCCACAGTAGGGG + Intergenic
1122783553 14:104153766-104153788 GGTGCCTGTGCCCACCATCCTGG - Intronic
1122819740 14:104335414-104335436 GCTGCCTGTCCCCACAGGCTGGG - Intergenic
1123500607 15:20878010-20878032 GCTGCCAGCGCCAACCTTCCCGG - Intergenic
1123557852 15:21451703-21451725 GCTGCCAGCGCCAACCTTCCCGG - Intergenic
1123594079 15:21888984-21889006 GCTGCCAGCGCCAACCTTCCCGG - Intergenic
1124086735 15:26558366-26558388 ACTGCCTGTGCCCATAGACCTGG - Intronic
1124630523 15:31334274-31334296 GCTGCCTGTGGCCACAGGGCCGG - Intronic
1125528393 15:40394461-40394483 GCAGCAAGTGGCCACAGACCTGG - Intergenic
1126914715 15:53453083-53453105 GCAGCCACTGCCCACTGCCCAGG + Intergenic
1127261563 15:57330359-57330381 GCTGCCAGTGCTCCCAGGACTGG - Intergenic
1129374086 15:75116472-75116494 GCTGGCAGTCCTCACAGCCCTGG - Intronic
1129993439 15:79984446-79984468 GCTTCCAGTGCTCAATGTCCTGG - Intergenic
1130223691 15:82043126-82043148 GCTGCTAGTGCGCACCGTGCTGG - Exonic
1130919841 15:88334798-88334820 GCAGCCGGTGCCCACTGCCCAGG + Intergenic
1131641773 15:94300901-94300923 GCTCCCAGTGCCTCCAATCCAGG - Intronic
1131674332 15:94655499-94655521 ACTCCCAGTGCTGACAGTCCTGG - Intergenic
1202966203 15_KI270727v1_random:178875-178897 GCTGCCAGCGCCAACCTTCCCGG - Intergenic
1132513438 16:354843-354865 CCTGCCAGGTCCCACAGTGCTGG + Intergenic
1132973358 16:2699750-2699772 GCTGCCTGTGGCCCCAGCCCAGG - Intronic
1133273570 16:4623739-4623761 CCTTCCAGAGACCACAGTCCAGG - Intronic
1133412651 16:5581007-5581029 GCTGTCAGTGTGCACAGACCTGG + Intergenic
1134232203 16:12437901-12437923 GCTGCAGCTGCCCACAGCCCAGG + Intronic
1134640756 16:15827608-15827630 GCTGCAAGTGCCTTGAGTCCGGG + Intronic
1141287123 16:82682903-82682925 ACAGCCATTGCCCACAGTTCAGG + Intronic
1143179093 17:4973235-4973257 GCTTCCAGTCTCCACACTCCTGG + Exonic
1143697350 17:8630426-8630448 GGTCCCAGTGCCCCCAGCCCAGG + Intronic
1143882001 17:10036867-10036889 GCTGCCCTTGTCCACAGGCCTGG - Intronic
1144091108 17:11857379-11857401 GCAGGGAGTGCCCACATTCCTGG - Intronic
1144669990 17:17127443-17127465 GTTGAGAGAGCCCACAGTCCAGG + Intronic
1145027364 17:19478293-19478315 GCTGCCAGGACCCCCAGTGCAGG - Intergenic
1145259809 17:21347968-21347990 GCTGGCAGAGCTCACAGGCCTGG + Intergenic
1145277247 17:21439400-21439422 GGTGCCAGTGTCCTCAGTCCTGG - Intergenic
1145315083 17:21725294-21725316 GGTGCCAGTGTCCTCAGTCCTGG - Intergenic
1145316806 17:21739970-21739992 GCTGGCAGAGCTCACAGGCCTGG - Intergenic
1145976941 17:28989206-28989228 CCTGCCAGTTCTCACATTCCAGG + Intronic
1147257540 17:39191068-39191090 GCAGCCAGAGCCTATAGTCCCGG + Intronic
1147673967 17:42192531-42192553 GCCTCCAGTGCCCTCAGCCCTGG + Exonic
1148475841 17:47928046-47928068 ACGGCCAGTGTCCACAGTCTGGG - Exonic
1149395682 17:56239888-56239910 GCTGTCCTTGCCCATAGTCCTGG - Intronic
1150227358 17:63531243-63531265 GGCTCCAGTGACCACAGTCCTGG + Intronic
1150290519 17:63978962-63978984 GCTGCCACAGCTGACAGTCCTGG + Intergenic
1150605332 17:66685949-66685971 GTTGCCAGTGCCGCCGGTCCAGG + Intronic
1150801998 17:68290482-68290504 GCTGACAGTTCTGACAGTCCAGG + Intronic
1152249865 17:79206743-79206765 GCTGCCATAGCCCACAGCGCAGG - Intronic
1152380737 17:79941233-79941255 GCAGGCAGAGCCCTCAGTCCAGG - Intronic
1152843859 17:82587298-82587320 GCTCCCAGTACCCACAGCCACGG - Intronic
1155987284 18:32243572-32243594 GGGGCCAGTGCCCACAGATCTGG + Intronic
1157239750 18:45997952-45997974 ACTCCCAGTGCTCAGAGTCCTGG - Intronic
1157281561 18:46349610-46349632 GCTGCCAGTGGTCACAGTTCTGG + Intronic
1157399326 18:47373880-47373902 CCTGGCAGATCCCACAGTCCTGG - Intergenic
1160440323 18:78884516-78884538 GCTGCCTGTGCCCACCATCAGGG + Intergenic
1160522879 18:79518845-79518867 GCGGCCAGTGCCCACGGTGCAGG + Intronic
1160707457 19:536174-536196 GCTCCCAGTGCCCCAGGTCCCGG - Intronic
1161849102 19:6729814-6729836 GCTCCCAGTGCCCAGAGTGGGGG - Intronic
1162533080 19:11247012-11247034 GCTGAAAGTGCCTAGAGTCCTGG - Intronic
1162760396 19:12885486-12885508 GAGTCCAGTGCCCACCGTCCCGG + Exonic
1164527588 19:29023201-29023223 GATGGCAGTGGCCACAGTCTTGG - Intergenic
1165906407 19:39197120-39197142 GCTGCCATCGCCCGCAGCCCCGG + Exonic
1166369058 19:42291400-42291422 GCTGCCACTGCACCCACTCCTGG + Exonic
1166643287 19:44512663-44512685 TCTGCCTGTTCCAACAGTCCCGG - Intronic
1166717430 19:44977476-44977498 GCAGCCAGGACCCACTGTCCAGG + Intronic
1167049533 19:47069939-47069961 GGTGCCAGTGCCCACGCTGCAGG - Intronic
1167725862 19:51212139-51212161 GCCACCAGTGGCCCCAGTCCTGG - Intergenic
1167881114 19:52458051-52458073 GCTGGCAGTGCCTCCAGACCTGG - Intronic
926075903 2:9942470-9942492 GATGCCAGTACCCACAGGGCAGG + Intergenic
927494952 2:23545995-23546017 ACTGCCTGTGCCTACAGACCGGG + Intronic
927679738 2:25131742-25131764 GCTCTCAGGGCCCACAGTACTGG + Exonic
927685381 2:25167450-25167472 GCTGCCCGTGCCCTCAACCCAGG + Intronic
929802114 2:45112965-45112987 GAAGCCAGTGGGCACAGTCCAGG - Intergenic
929821539 2:45277986-45278008 GCAGCCAGAGCCCTCAGACCTGG + Intergenic
930145243 2:47995667-47995689 ACTGGCACTGCTCACAGTCCAGG + Intergenic
933995852 2:87669290-87669312 CCTGCCAGTGCCTTCAGACCTGG - Intergenic
934777484 2:96948722-96948744 GCTGCCAGGGCCCTGAGCCCAGG + Intronic
935376190 2:102400046-102400068 GCTGATAGTGATCACAGTCCAGG + Intergenic
935991028 2:108719294-108719316 GCCGCCAGTGTCCACAGCCTAGG - Intergenic
936053399 2:109242414-109242436 GCAGCCCGTGCCTAGAGTCCTGG + Intronic
936298005 2:111281622-111281644 CCTGCCAGTGCCTTCAGACCTGG + Intergenic
936451693 2:112638549-112638571 CCTGCCAGGGCCCACCGTGCAGG + Intergenic
936863644 2:117052812-117052834 GCTGCGACTGCCCACATTCATGG + Intergenic
938141692 2:128799639-128799661 TCTGCCCATGCACACAGTCCTGG - Intergenic
938243860 2:129762752-129762774 GGAGCCAGTGCCCACCCTCCAGG - Intergenic
942299678 2:174549073-174549095 GCTGGCAGTCCTCACAGCCCTGG - Intergenic
947352535 2:229261431-229261453 GTTGCCACTGCCCACATTACAGG + Intronic
948204665 2:236156916-236156938 TGTGCCAGTGCCCACAGTCCCGG + Intergenic
948760638 2:240188396-240188418 GCTGCCCGTTCTCACAGTGCAGG - Intergenic
948869800 2:240792182-240792204 GCTGCCTGTCTCCACAGGCCTGG - Intronic
1168991268 20:2097639-2097661 GTGGCATGTGCCCACAGTCCCGG + Intergenic
1170778567 20:19402893-19402915 GTGGCCAGTGGCCACTGTCCTGG - Intronic
1170886050 20:20340610-20340632 GCTGCCTGTTCCAACAGCCCAGG - Intronic
1170989801 20:21291708-21291730 GCTGGCAGTCCTCACAGCCCTGG + Intergenic
1172099724 20:32477901-32477923 GCACCCAGTGCCCACAGGCACGG + Intronic
1172117030 20:32579168-32579190 GCTGCCAAGGCCCACAGCCCAGG + Intronic
1173825350 20:46044586-46044608 GCTGTGAGTGCTCACTGTCCTGG + Intronic
1175108484 20:56630311-56630333 GCTGCCCCTGCCCGCAGGCCCGG + Intronic
1175627684 20:60502487-60502509 GCCTCCATGGCCCACAGTCCTGG - Intergenic
1175863874 20:62164239-62164261 GCCGCCAGTGCTCACCGTCGGGG - Exonic
1176284364 21:5011682-5011704 GCTCGCAGGGCCCACAGGCCAGG - Intergenic
1177318650 21:19493443-19493465 GCTGGCAGCGCTCACAGCCCTGG + Intergenic
1178074097 21:29000010-29000032 GCTGGCAGTCCTCACAGCCCTGG + Intergenic
1178162770 21:29938953-29938975 CTTGCCAGTGCCCAGAGCCCAGG + Intronic
1178314103 21:31554888-31554910 GCTTCCCATGCCCACAGTCTAGG + Intronic
1179787358 21:43737475-43737497 CTTCCCAGTGCCCTCAGTCCGGG - Intronic
1179872817 21:44251793-44251815 GCTCGCAGGGCCCACAGGCCAGG + Intronic
1180143793 21:45908811-45908833 GCGGCCTGTGCCCACCCTCCTGG - Intronic
1180921984 22:19525690-19525712 GCACCCAGTGGCCTCAGTCCAGG - Intronic
1181083761 22:20429905-20429927 GCGGCCAGGGCCCAGGGTCCAGG + Intronic
1181580830 22:23827253-23827275 GCTGCCAGTGCCCACAGTCCAGG + Intronic
1182635819 22:31726180-31726202 GCTGACAGCGCGCACAGTCTTGG - Intronic
1183494293 22:38133647-38133669 GCTGGCAGTGCCCTCCCTCCTGG + Intronic
1183935075 22:41257329-41257351 GCTGCCAGTGGTAACAGTGCTGG - Intronic
1184411402 22:44328502-44328524 GCTGTCTGTGTCCACAGTACAGG - Intergenic
1184422793 22:44391582-44391604 GGTGCCAGTGCCTAGACTCCGGG - Intergenic
1184729252 22:46364022-46364044 GCTCCCAGTGCGCACATTCATGG + Exonic
1184736279 22:46399543-46399565 GATGCCAGTGACCTCAGTACAGG + Intronic
1184772644 22:46606984-46607006 GCTTCCAGTGCCCACAGCTGGGG - Intronic
1184886840 22:47351830-47351852 GCTGCCTCTGCCCGCATTCCAGG + Intergenic
1185070213 22:48651922-48651944 ACTGCCAGGACCCACAGCCCAGG - Intronic
953657339 3:44864104-44864126 GGTGCCAGCAACCACAGTCCTGG + Intronic
954124144 3:48518853-48518875 GCTGCCAGTGTCCACAGCCAGGG + Exonic
954219353 3:49143569-49143591 GCTGGCAGTGCCCACTGTGGGGG + Intergenic
954780008 3:53051783-53051805 TCTGCCAGTCCCCAGGGTCCAGG - Intronic
955154009 3:56397889-56397911 CCTCCCAGTGTCCACATTCCAGG + Intronic
955920165 3:63946954-63946976 ACTGCCAGTGCCCAAGGTCAAGG - Intronic
957446057 3:80314337-80314359 GCTGGCAGTCCTCACAGCCCTGG + Intergenic
960038840 3:113128786-113128808 GCCGCCAGACCCCACAGGCCAGG - Intergenic
960199485 3:114813179-114813201 GCTGGCAGTCCTCACAGTCCTGG - Intronic
960286479 3:115835698-115835720 GTATCCAGTGCCCAAAGTCCAGG - Intronic
961535015 3:127565205-127565227 GCTGGCAAAGCCCAAAGTCCAGG - Intergenic
964381020 3:156099302-156099324 GCTGGCAGTCCTCACAGCCCTGG + Intronic
966551416 3:181208641-181208663 GGTGCCACTGCCCTCAGGCCTGG + Intergenic
966928358 3:184659979-184660001 TCTGTCAGTGCCCACAGCCCAGG + Intronic
968332495 3:197883673-197883695 CAGGCCAGTGCCCACCGTCCTGG - Intronic
968481937 4:837114-837136 GCTCCTGGTGCCCACAGGCCTGG + Intergenic
969881635 4:10179043-10179065 GCTGCCATTGCAGACACTCCCGG - Intergenic
970424458 4:15933569-15933591 TCTGCCAGTGACCAGAGGCCAGG + Intergenic
974792845 4:66712939-66712961 GCTGGCAGTCCTCACAGCCCTGG - Intergenic
977683105 4:99816742-99816764 CCTGCCAGTGCCTCCAGGCCAGG + Intergenic
980738179 4:136917786-136917808 GATGCCTGTGTCCACAGTCACGG - Intergenic
983060260 4:163152680-163152702 GCTGGCAGTCCTCACAGCCCTGG + Intronic
983229294 4:165112987-165113009 GTAGCCACCGCCCACAGTCCAGG - Intronic
984954689 4:185033627-185033649 GCTTCCAGTCCTCTCAGTCCTGG - Intergenic
985087012 4:186324419-186324441 GCTGGCAGTCCTCACAGCCCTGG + Intergenic
985492172 5:186509-186531 GCTCCCAGCGCCCCCAGTGCTGG - Exonic
985576788 5:677351-677373 GCAGCCACTGCCCCCACTCCTGG + Intronic
985908796 5:2863366-2863388 GCCCCCAGGGCCCACATTCCTGG - Intergenic
986327229 5:6685235-6685257 GCTGCCAATGCCCTCCCTCCAGG - Intergenic
987118638 5:14746115-14746137 GCTGTCAGTTCCCCCCGTCCTGG - Intronic
991604194 5:68383862-68383884 GCTCCTGGTGCCCACAGTTCAGG + Intergenic
994996298 5:107067585-107067607 GCTGCCAGGGCACACTGTCTGGG - Intergenic
995568593 5:113456979-113457001 GCTGGCAGTCCTCACAGCCCTGG + Intronic
997641743 5:135452908-135452930 GCAGCCAGAGCCCGCAGTGCTGG - Intergenic
999238360 5:150113406-150113428 GCTGCTAGAGCCCAGATTCCAGG - Intergenic
1001324737 5:170714182-170714204 CCTCCCACTGCTCACAGTCCAGG + Intronic
1001436429 5:171702998-171703020 CCTGCCAGTGTCCAAAGCCCTGG - Intergenic
1001550014 5:172595967-172595989 GCTGCCTGGGTCCACAGTCCTGG + Intergenic
1002132699 5:177091231-177091253 GCTGCCCAGGTCCACAGTCCAGG - Intronic
1002826046 6:775441-775463 GATCCCCGTGCCCACATTCCTGG + Intergenic
1003309937 6:4961729-4961751 CCTGCCAGTGCCCACAGGAGCGG + Intergenic
1003382304 6:5636394-5636416 GCTGCCAGGGCCCACAGTTCTGG - Intronic
1005876263 6:30011959-30011981 CCTACCTGTGCCCACAGCCCAGG - Intergenic
1006373696 6:33660067-33660089 GCTCCCTCTGCCCTCAGTCCTGG - Intronic
1007181904 6:39934584-39934606 GCTCCCTGTGCCCACTTTCCTGG + Intergenic
1010938776 6:81891272-81891294 GATGCCAGTGCCTACTGTTCTGG - Intergenic
1013836750 6:114343025-114343047 GCTGCCAGTCCACACCCTCCCGG + Exonic
1017432290 6:154382773-154382795 GCTGCCACTCACCACAGGCCTGG - Intronic
1017626205 6:156351689-156351711 GCTTCCAGTGCCTGAAGTCCAGG - Intergenic
1018034593 6:159871473-159871495 GCTGCCAGTGGCTATACTCCTGG - Intergenic
1019789693 7:3003022-3003044 GCTGGCAGTGTCCGCAGCCCGGG - Intronic
1021633384 7:22667693-22667715 ACTGCAAGTTCCCACAGTTCAGG + Intergenic
1021923117 7:25506581-25506603 GCAGCAAGTTCCCAAAGTCCTGG - Intergenic
1022691877 7:32664047-32664069 TCTGCCTGTGGCCAGAGTCCGGG - Intergenic
1022919539 7:34998588-34998610 TCTGCCTGTGGCCAGAGTCCGGG - Intronic
1022944031 7:35264460-35264482 ACTCCTAGGGCCCACAGTCCAGG - Intergenic
1024628078 7:51225437-51225459 GCTGGCAGTGCACACAGGCTGGG + Intronic
1025098538 7:56116320-56116342 GCCGCCGGTGGCCACAGGCCTGG - Exonic
1029126409 7:98297773-98297795 GCCGCCAGTGCCCCCGGTGCAGG - Intronic
1029611455 7:101628715-101628737 GCTGCCAGGGCCGGCAGTGCTGG + Intronic
1031509042 7:122625708-122625730 CTTGCCAGTGCCCACAGCCGTGG + Intronic
1032139043 7:129309639-129309661 GCTGCCAGCCCCCGCATTCCTGG + Intronic
1033164654 7:139029451-139029473 GCAGCCAGTGCCCACAGCAGCGG - Intronic
1034413886 7:150955150-150955172 CCTGCCATGGCCCACAGTCCTGG - Intronic
1034541917 7:151763859-151763881 GCTGACAGTGCCCTGAGCCCAGG + Intronic
1034646198 7:152649980-152650002 GCTCCGTGTGCCCAGAGTCCTGG - Intronic
1035237583 7:157508858-157508880 GCTGCCAGTGCCCTCAGCTCTGG - Intergenic
1035662401 8:1358050-1358072 GCTGCCTGTGCCCCCACTCCTGG - Intergenic
1036007528 8:4683648-4683670 GCTGGGAGTCCCCACACTCCAGG - Intronic
1036162807 8:6405841-6405863 GCTGGCACTACCCACTGTCCCGG - Intergenic
1037434173 8:18845523-18845545 GCTGACACTGCCCACAGTGTTGG - Intronic
1037877456 8:22554924-22554946 GCCCCCATTGCACACAGTCCTGG - Exonic
1040014373 8:42689328-42689350 GCTGGCAGTCCTCACAGCCCTGG + Intergenic
1040389002 8:46933692-46933714 GCTCCCAGAGCCCACAGGCCTGG + Intergenic
1040530264 8:48260905-48260927 GCTGCCAGACCCCGCAGTACAGG - Intergenic
1042022001 8:64378301-64378323 TCAGCCAGTGGCCACAGTCTGGG - Intergenic
1043356996 8:79425350-79425372 GCTGCCAGGGCCCAGAGTTGAGG - Intergenic
1043835315 8:85038556-85038578 GCTGCAAGTCTCCACAGACCAGG + Intergenic
1049148143 8:141017173-141017195 GGTGCCAGTGCCCACTCCCCTGG + Intergenic
1051628452 9:19120998-19121020 GCTGCCACTGACCACAGACTTGG + Exonic
1055650150 9:78398971-78398993 GCTGCCAGTGTCTAAAGACCTGG + Intergenic
1056967531 9:91177712-91177734 GCTGCCACGGCCCACAGGCCTGG + Intergenic
1057511053 9:95680166-95680188 GCTGGCAGTCCTCACAGCCCTGG + Intergenic
1057547042 9:96026486-96026508 ACTGCCAACGCCCACAGGCCAGG + Intergenic
1057929866 9:99184239-99184261 GCAGACATTGGCCACAGTCCCGG + Intergenic
1059446503 9:114341611-114341633 GTTGCCAGATACCACAGTCCGGG + Exonic
1061827842 9:133273088-133273110 GCTGGCAGTGCACCCAGTCCCGG - Intronic
1061909172 9:133713718-133713740 GCTCTCTGTGGCCACAGTCCTGG + Intronic
1062095438 9:134700840-134700862 GCTCCCAGGGACCACACTCCTGG + Intronic
1062459027 9:136655180-136655202 GCTGCCACTGGCCACCATCCTGG - Intergenic
1185464316 X:345996-346018 GGTTCCAGTGCTCACAGGCCTGG + Intronic
1192152242 X:68719486-68719508 GCAGGCAGGGCCCACAGGCCAGG + Intronic
1197177321 X:123499969-123499991 GCTGCCAGTGCTCACATGCGTGG - Intergenic
1197678708 X:129359361-129359383 GCTGGCAGTGGCCAGAGCCCTGG - Intergenic
1198683770 X:139206546-139206568 GCTGCCCCTGCTCCCAGTCCAGG + Intronic
1199356326 X:146867405-146867427 GCTGGCAGTCCTCACAGCCCTGG - Intergenic
1199535534 X:148898439-148898461 GGTGGCAGTGGCCATAGTCCTGG + Intronic
1200044822 X:153395860-153395882 ACTGCCAGAGTCCACTGTCCTGG - Intergenic