ID: 1181581005

View in Genome Browser
Species Human (GRCh38)
Location 22:23827980-23828002
Sequence ACTCCTGGTCTAGCTCTCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 161}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181581005_1181581011 10 Left 1181581005 22:23827980-23828002 CCACAGAGAGCTAGACCAGGAGT 0: 1
1: 0
2: 1
3: 17
4: 161
Right 1181581011 22:23828013-23828035 TCTCTGCCACACAGAAAGCTTGG 0: 1
1: 0
2: 3
3: 36
4: 563

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181581005 Original CRISPR ACTCCTGGTCTAGCTCTCTG TGG (reversed) Intronic
901476073 1:9490500-9490522 ACTCCATGTCCAGCTTTCTGAGG + Intergenic
902783677 1:18719764-18719786 TCTCCTTGTCTAGGTCTCTGGGG + Intronic
904410752 1:30323473-30323495 GCTCATGGTCAACCTCTCTGAGG - Intergenic
904884203 1:33724304-33724326 ACTCCTTCTGTAGCTCTCTGTGG - Exonic
905791205 1:40790747-40790769 AGGCATGGTCTAGCTCTCTCTGG - Intronic
905920840 1:41717642-41717664 ACTCCTTGTCTAGTGCTCTTGGG + Intronic
907319175 1:53592149-53592171 ACTCAGGGTCTCTCTCTCTGCGG - Intronic
911157100 1:94647527-94647549 ACACCTGATCCAGTTCTCTGAGG - Intergenic
912055798 1:105596838-105596860 ATTCCTGCCCTAGCTATCTGTGG + Intergenic
916829173 1:168473847-168473869 ACCCCTGCTCTAGATATCTGTGG + Intergenic
919392564 1:197005745-197005767 ACTTCTGGTCTAGCCCTGTGAGG - Intronic
919981962 1:202647366-202647388 TCTCCTGGGCCAGCTTTCTGTGG + Intronic
922752835 1:228078909-228078931 TCCCCTGGACTAGCTCTCAGGGG - Intergenic
923495328 1:234519648-234519670 ACTCCTGGTGTATGTCTGTGGGG - Intergenic
924106106 1:240650686-240650708 ATTCCTCGTCTTGCTTTCTGAGG + Intergenic
1063051671 10:2456206-2456228 ACTCCTGGTAGCTCTCTCTGGGG + Intergenic
1070008545 10:72449921-72449943 ACTCCCTCTCCAGCTCTCTGTGG - Intronic
1071555402 10:86597621-86597643 CCGCCTGGCTTAGCTCTCTGTGG + Intergenic
1072896214 10:99369234-99369256 AATCATTGTCTAGCTCTATGAGG - Intronic
1073165596 10:101446847-101446869 ATTCCTGGTTTAGATCTTTGGGG - Intronic
1078578636 11:12521825-12521847 ACTCATGTTCTAACCCTCTGGGG - Intronic
1079349125 11:19677923-19677945 ACCCCTGGTCTAACCCACTGAGG + Intronic
1080367284 11:31590296-31590318 AGTCCTGGTCTAGTTTTTTGTGG - Intronic
1083473791 11:62902386-62902408 GCTCCTGGGCTGGCTCTCTGCGG + Intergenic
1088081695 11:105924507-105924529 ACTCCTGGTTTGGATTTCTGAGG - Exonic
1089175757 11:116547783-116547805 ACTGCTGCTGTAGCCCTCTGGGG + Intergenic
1089853305 11:121518572-121518594 ACCTCTGCTCTACCTCTCTGAGG - Intronic
1090261552 11:125324652-125324674 CCTCCTGATCCATCTCTCTGGGG - Intronic
1090711582 11:129391151-129391173 ATCCCTGGTCTAGCTTTCTGTGG - Intronic
1096738372 12:53674043-53674065 CTTCCTGGTCAAGATCTCTGGGG + Intronic
1098878173 12:75888797-75888819 CCTCATGCTCTAGCTTTCTGGGG - Intergenic
1101890824 12:108713590-108713612 TCTCCAGGCCTAGCTCTGTGAGG - Intronic
1103706577 12:122877733-122877755 ACTAAGGGTCTAGCTCTGTGTGG - Intronic
1104768653 12:131346438-131346460 CCACCTTGTGTAGCTCTCTGAGG + Intergenic
1104811371 12:131622152-131622174 CCACCTTGTGTAGCTCTCTGAGG - Intergenic
1109771023 13:66973441-66973463 CCTCCTTTTCTAGCTGTCTGTGG - Intronic
1111815378 13:93146638-93146660 ACACCTTGGCTATCTCTCTGGGG - Intergenic
1112113968 13:96332923-96332945 AAGGCTGATCTAGCTCTCTGAGG - Intronic
1114197747 14:20494039-20494061 ATTCCTCCTCTTGCTCTCTGAGG - Intergenic
1114365320 14:22020275-22020297 ACTCATGGTGTAGCTCTCGATGG + Intergenic
1119615147 14:76094170-76094192 CCTCCTGATCTAGCTCTCAGGGG - Intergenic
1122811957 14:104293536-104293558 ACACCTGGGCCAGCGCTCTGAGG - Intergenic
1123486621 15:20746098-20746120 ACTCTTGTTCTAGATCCCTGAGG - Intergenic
1123543111 15:21315148-21315170 ACTCTTGTTCTAGATCCCTGAGG - Intergenic
1123627118 15:22235187-22235209 ACTCCTCCTCTTGCTTTCTGAGG + Intergenic
1125251726 15:37712850-37712872 ACTCCTGCTCTAGGGATCTGTGG + Intergenic
1126584327 15:50267848-50267870 ACTCTAGGTTTAGCTTTCTGGGG - Intergenic
1127735489 15:61835196-61835218 ACTCCTGCACTGGCACTCTGTGG - Intergenic
1127836140 15:62792729-62792751 CCTCTTGGTGTAGCTGTCTGTGG - Exonic
1128215054 15:65928807-65928829 ACTCCTGCTCTACTTCTCAGTGG + Intronic
1202951429 15_KI270727v1_random:42278-42300 ACTCTTGTTCTAGATCCCTGAGG - Intergenic
1132647904 16:1007526-1007548 GCGCCTGGAATAGCTCTCTGGGG + Intergenic
1132860481 16:2069005-2069027 ACACATGGTCTTGCTCTCTCGGG + Intronic
1133191902 16:4140028-4140050 AAGCCTGGTTTACCTCTCTGGGG + Intergenic
1134689701 16:16183067-16183089 AGTCCTTGTCTAGCTATTTGAGG + Intronic
1140430560 16:74899264-74899286 AGTCCTGGTCTAGTTCACAGAGG - Intronic
1140940595 16:79718414-79718436 ACAGTTGGCCTAGCTCTCTGGGG - Intergenic
1140963541 16:79941554-79941576 ACTGATGGGCTAGCTGTCTGGGG + Intergenic
1141976846 16:87522200-87522222 ACTCCTCCTCTTGCTTTCTGAGG - Intergenic
1142768861 17:2082181-2082203 ACTTATGGTGTAACTCTCTGAGG - Intronic
1144370231 17:14583552-14583574 ATTCCCGTTCCAGCTCTCTGAGG + Intergenic
1145883427 17:28367599-28367621 ACTTCTGGCCTGGCTTTCTGTGG + Intronic
1146484951 17:33235307-33235329 ACTCCTGGCCTCCCTCCCTGTGG + Intronic
1148566453 17:48635723-48635745 ACTGCTGGCCTGGGTCTCTGTGG + Intergenic
1148580158 17:48738190-48738212 ACTGCTGGTCTAGCTCTGTGAGG + Intergenic
1153585111 18:6612806-6612828 AGTCTTGGTATAGCTCTCTGTGG - Intergenic
1155339547 18:24799872-24799894 ACTCCGAGTCCAGCACTCTGTGG - Intergenic
1155770843 18:29696168-29696190 ACTTCTGTTTTAGCTCTTTGAGG + Intergenic
1160221948 18:76984426-76984448 ACTCCTGCTTTAGCTCCCTGAGG + Intronic
1161138041 19:2632139-2632161 ACTCCTGGCCTGGCGCTGTGTGG + Intronic
1162027333 19:7901870-7901892 AGTCCTTGAATAGCTCTCTGGGG - Exonic
1163186532 19:15642702-15642724 CCTCCTGCTCTATCTCTCTTGGG - Intronic
1163218212 19:15896313-15896335 CCTCCTGCTCTATCTCTCTTGGG + Intronic
1164404413 19:27930761-27930783 ACTGCTGGTCAGGCTTTCTGGGG - Intergenic
1165717748 19:38057517-38057539 ACTCCTGGTGTTGCTCATTGAGG + Intronic
1166141165 19:40806161-40806183 ATTCCTGGTCTAGGGCTGTGAGG + Intronic
1167138422 19:47632542-47632564 CCTCCTGGTCACGCTCCCTGCGG - Intronic
1168406696 19:56114308-56114330 AGGCCTGGTCTTTCTCTCTGAGG + Intronic
1168406712 19:56114362-56114384 AGGCCTGGTCTCTCTCTCTGAGG + Intronic
1168406744 19:56114466-56114488 AGGCCTGGTCTTTCTCTCTGAGG + Intronic
1168406761 19:56114520-56114542 AGGCCTGGTCTCTCTCTCTGAGG + Intronic
925016132 2:525672-525694 AGTCCTGGGCCAGCTCCCTGTGG - Intergenic
925187603 2:1859905-1859927 ACTCCTGGGCTTGTTTTCTGGGG + Intronic
925417382 2:3680150-3680172 ACTCCTAGTAGAGCGCTCTGTGG + Intronic
925818446 2:7776171-7776193 CATCCTGGCCTTGCTCTCTGAGG + Intergenic
927828361 2:26326191-26326213 TCTCCAGGTCTACCTGTCTGGGG + Intronic
927854276 2:26518072-26518094 CCTTCTGTTCTAGCTCCCTGTGG + Intronic
928248832 2:29656781-29656803 ACGCCATGTCTACCTCTCTGTGG - Intronic
930252856 2:49054617-49054639 ACTCAGGGTCTGGCTCACTGGGG - Intronic
933492152 2:82999146-82999168 AGTCATGCTCTACCTCTCTGAGG + Intergenic
936490055 2:112962201-112962223 ATGCCTGGTCCAGCTATCTGTGG - Intergenic
937696535 2:124814463-124814485 ACTCCTGGCCTAGCACAATGTGG + Intronic
940036402 2:149316431-149316453 ACTCCATGTTTAGCACTCTGTGG - Intergenic
941282764 2:163573632-163573654 ACTCCTAGAGTAGGTCTCTGGGG + Intergenic
945208558 2:207358280-207358302 ACTCCTTGCCTAGATCTCAGGGG + Intergenic
1169167171 20:3434027-3434049 CTTGCTGGTCTTGCTCTCTGGGG - Intergenic
1170141625 20:13130685-13130707 TCTCCTGGTCTGTCACTCTGAGG + Intronic
1170158749 20:13291771-13291793 ATTCTTTGTCTAGCTCACTGAGG - Intronic
1173188088 20:40856624-40856646 ACTCCTGGGCTTCCTGTCTGGGG - Intergenic
1175377779 20:58541239-58541261 ACTCCAGGGCCAGTTCTCTGTGG + Intergenic
1175566451 20:59982745-59982767 AGTACTGTTCTTGCTCTCTGGGG + Intronic
1178228485 21:30753029-30753051 ACACCAAGTCTGGCTCTCTGAGG - Intergenic
1180214299 21:46314850-46314872 CCTCCTGGACGAGCTCTCTCGGG - Exonic
1181581005 22:23827980-23828002 ACTCCTGGTCTAGCTCTCTGTGG - Intronic
1182295477 22:29309397-29309419 ACTCTTGGTCCAGCCCTCAGGGG - Intronic
1184963606 22:47950061-47950083 ATGCCTGGTCTCGATCTCTGAGG - Intergenic
950834585 3:15906820-15906842 CCACCTGATCTAGCTCTCTCAGG + Intergenic
951710618 3:25582122-25582144 TCTGGTGGTCTAGCTCACTGTGG - Intronic
952327036 3:32330265-32330287 ACTACTGTTTTGGCTCTCTGGGG - Intronic
952973353 3:38671379-38671401 ACTCCTGTTCTTCCCCTCTGGGG + Intergenic
957088326 3:75704178-75704200 ACTCCTGCTCTTGTTTTCTGAGG + Intergenic
957352001 3:79036364-79036386 ACCACTGGTCTGGTTCTCTGTGG + Intronic
957745093 3:84330345-84330367 ACTCCTGGTGTAGCTATTTTTGG + Intergenic
958612623 3:96447028-96447050 ACTCCTTGCTTAGTTCTCTGGGG + Intergenic
960337381 3:116435081-116435103 AAACCTGGTCTAGCTCTGTGGGG - Intronic
961416077 3:126758055-126758077 ACTCTTGGGCAAGCCCTCTGTGG + Intronic
962423789 3:135251026-135251048 AGTCCAGCTCTACCTCTCTGAGG + Intronic
962906845 3:139811453-139811475 ATTCCTGGTTTAGATCTTTGTGG + Intergenic
963850207 3:150203488-150203510 AATGCTGGTCTGACTCTCTGTGG - Intergenic
964684345 3:159378637-159378659 ACTCCCGGTATAGCACTCTCAGG + Intronic
967821523 3:193843271-193843293 ACTCCTGGACTAAATCTCTAAGG - Intergenic
968957184 4:3725397-3725419 ATTCCGGGGCTGGCTCTCTGTGG + Intergenic
969339725 4:6532500-6532522 TCTCCAGATCTAGCTGTCTGGGG + Intronic
971864259 4:32148279-32148301 ACCCATTGTCTAGCTCTCAGTGG - Intergenic
972463648 4:39330537-39330559 ACTCCTGGTCTAGCTGATTGTGG - Intronic
973833282 4:54783646-54783668 CCTACTGGTCTAGCACTTTGGGG - Intergenic
975396706 4:73883430-73883452 ACTCATGGTCTACCCCTCTGTGG + Intergenic
976287979 4:83388408-83388430 ACTGCTGGGCTTGCTGTCTGGGG - Intergenic
981533463 4:145775381-145775403 CCTTCTGGGCTAGTTCTCTGGGG + Intronic
984024234 4:174523311-174523333 ACTCCAGGGCTAGCTGTATGCGG + Intergenic
985485236 5:145089-145111 AGTCCAGCTCTTGCTCTCTGGGG + Intronic
986343987 5:6817417-6817439 GCTCGTTTTCTAGCTCTCTGTGG + Intergenic
987975884 5:25014618-25014640 ATTTCTGGTCTAGGTCTTTGAGG - Intergenic
991201458 5:63998855-63998877 ACTGCTGTACTGGCTCTCTGTGG - Intergenic
991365413 5:65862768-65862790 ACCACTGTTCTACCTCTCTGTGG + Intronic
992843502 5:80720026-80720048 ACTTTGGGTATAGCTCTCTGTGG + Intronic
992947185 5:81822292-81822314 GCTCCTGGTCTAGGGCTCAGGGG + Intergenic
993114854 5:83708159-83708181 AGTTCTGCTTTAGCTCTCTGAGG - Intronic
993914329 5:93723952-93723974 ACTCTTGCTCTAAATCTCTGTGG - Intronic
997568783 5:134909639-134909661 ACTCCTGGTCTATTGCTCTTTGG - Intronic
998639064 5:143988819-143988841 ACTCCTGGTCTAGTCATCTGTGG + Intergenic
999188166 5:149728330-149728352 ACTCCTAGTCTAGGGCTCTGAGG + Intergenic
999861161 5:155648108-155648130 ACTCCTGCTTCTGCTCTCTGCGG + Intergenic
1003273148 6:4624706-4624728 ACTTCTGGTGTGGTTCTCTGAGG + Intergenic
1005389705 6:25320779-25320801 ACCCCTGGTCTAGATCTTTAAGG - Intronic
1005880404 6:30053899-30053921 ACTCCTTGTCTCCTTCTCTGGGG + Intergenic
1006077901 6:31546129-31546151 ATTCGTGCTCTCGCTCTCTGCGG + Exonic
1012732542 6:102900527-102900549 ACTCCTGTTCTAGAGATCTGTGG - Intergenic
1013044798 6:106474612-106474634 ACTTCCGGTCTATCCCTCTGAGG + Intergenic
1018552215 6:165010782-165010804 ATTCCTGCTCTTGCTTTCTGAGG - Intergenic
1019845847 7:3500034-3500056 AGTCCTGGTCAGGCTCACTGGGG + Intronic
1022845993 7:34210264-34210286 TCTCCTGCTCAAACTCTCTGAGG + Intergenic
1024258916 7:47559641-47559663 CCTCCTGCTCTACATCTCTGAGG + Intronic
1024325243 7:48104351-48104373 ATACGTGGTCTTGCTCTCTGGGG + Intronic
1024936446 7:54716672-54716694 ATTCCAGTTCTAGCTCTCTGAGG + Intergenic
1025738194 7:64173659-64173681 AATCCTGTCCTAGATCTCTGGGG + Intronic
1030695141 7:112576956-112576978 TCTCATGGTGTAGCTCTGTGTGG + Intergenic
1032990573 7:137390492-137390514 ACCCCTGGGTTACCTCTCTGAGG + Intronic
1035406496 7:158602103-158602125 ACTCCTGGCCTAGGGCTTTGTGG - Intergenic
1036776529 8:11616755-11616777 ATTACTGGTATAGCTTTCTGTGG - Intergenic
1038739236 8:30202287-30202309 CTTCCTGGTCCAGCCCTCTGTGG - Intergenic
1042666753 8:71215598-71215620 ACTCCCGGTGAGGCTCTCTGCGG - Exonic
1044268776 8:90215138-90215160 AATCCTGGCTTAGCTTTCTGAGG + Intergenic
1045186741 8:99845724-99845746 ACTCCTGCTCTAGATAGCTGTGG - Intronic
1045263895 8:100602903-100602925 ATTCTTGGTCTTGCTTTCTGTGG - Intronic
1045274420 8:100689669-100689691 TCTGCTGGTCTAGGCCTCTGTGG + Intronic
1049113228 8:140662988-140663010 AATCCTGGTCTGGCTCTCACAGG + Intronic
1049925407 9:402305-402327 ACTCCTGGTCTAGGGATCTTTGG - Intronic
1052323458 9:27192824-27192846 ACTCCTGGTCTGTCTCCCTGGGG + Intronic
1052709352 9:32034373-32034395 GCTCCTGGTTTGGCACTCTGTGG - Intergenic
1054196664 9:62038754-62038776 ATTCCTGTTCTTGCTTTCTGAGG + Intergenic
1054641741 9:67549931-67549953 ATTCCTGTTCTTGCTTTCTGAGG - Intergenic
1059115451 9:111596982-111597004 ACTGCTGCTCTAGATCTATGGGG + Intronic
1061918679 9:133770275-133770297 ACTCCTGGTCTGGGTCTGTGAGG + Intronic
1187868513 X:23745253-23745275 ACTCCTGGACTAGCCAACTGTGG + Intronic
1189276645 X:39791123-39791145 GCTCCCTGTCAAGCTCTCTGTGG - Intergenic
1195382364 X:104282992-104283014 ACTCCTGCTCAAGCTCTGTGGGG - Intergenic
1195923510 X:110003798-110003820 TCTCCTGGACTGGCTCTATGGGG + Exonic
1196099547 X:111833083-111833105 ACTCCTAGTCTATCTCTATAAGG - Intronic
1201391401 Y:13501588-13501610 TCTCCCGCTCTAACTCTCTGGGG - Intergenic