ID: 1181582419

View in Genome Browser
Species Human (GRCh38)
Location 22:23835578-23835600
Sequence TGGGGAGTTCCACTCTTTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 77}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181582419_1181582431 17 Left 1181582419 22:23835578-23835600 CCATCAAAGAGTGGAACTCCCCA 0: 1
1: 0
2: 1
3: 5
4: 77
Right 1181582431 22:23835618-23835640 AGGGGACAGCTGGGCCTTACTGG 0: 1
1: 0
2: 1
3: 16
4: 204
1181582419_1181582430 8 Left 1181582419 22:23835578-23835600 CCATCAAAGAGTGGAACTCCCCA 0: 1
1: 0
2: 1
3: 5
4: 77
Right 1181582430 22:23835609-23835631 TGCACAGCAAGGGGACAGCTGGG 0: 1
1: 0
2: 0
3: 27
4: 355
1181582419_1181582432 21 Left 1181582419 22:23835578-23835600 CCATCAAAGAGTGGAACTCCCCA 0: 1
1: 0
2: 1
3: 5
4: 77
Right 1181582432 22:23835622-23835644 GACAGCTGGGCCTTACTGGAAGG 0: 1
1: 0
2: 1
3: 10
4: 143
1181582419_1181582423 -3 Left 1181582419 22:23835578-23835600 CCATCAAAGAGTGGAACTCCCCA 0: 1
1: 0
2: 1
3: 5
4: 77
Right 1181582423 22:23835598-23835620 CCAGAGCCCCATGCACAGCAAGG 0: 1
1: 0
2: 4
3: 32
4: 383
1181582419_1181582425 -1 Left 1181582419 22:23835578-23835600 CCATCAAAGAGTGGAACTCCCCA 0: 1
1: 0
2: 1
3: 5
4: 77
Right 1181582425 22:23835600-23835622 AGAGCCCCATGCACAGCAAGGGG 0: 1
1: 0
2: 3
3: 23
4: 173
1181582419_1181582424 -2 Left 1181582419 22:23835578-23835600 CCATCAAAGAGTGGAACTCCCCA 0: 1
1: 0
2: 1
3: 5
4: 77
Right 1181582424 22:23835599-23835621 CAGAGCCCCATGCACAGCAAGGG 0: 1
1: 0
2: 1
3: 16
4: 263
1181582419_1181582429 7 Left 1181582419 22:23835578-23835600 CCATCAAAGAGTGGAACTCCCCA 0: 1
1: 0
2: 1
3: 5
4: 77
Right 1181582429 22:23835608-23835630 ATGCACAGCAAGGGGACAGCTGG 0: 1
1: 0
2: 1
3: 28
4: 383

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181582419 Original CRISPR TGGGGAGTTCCACTCTTTGA TGG (reversed) Intronic
900609743 1:3539480-3539502 TGGTGGGTTCCACTCTTAGGAGG + Intronic
903109449 1:21117783-21117805 TGGGGAGTTCGCCTCTTTAGGGG + Intronic
904863981 1:33561981-33562003 TTGGGAATACCACTTTTTGAAGG + Intronic
906688285 1:47776775-47776797 TGAGGAGCTTCTCTCTTTGAAGG + Intronic
912553666 1:110500612-110500634 TGGACAGTTCCAGTTTTTGAAGG - Intergenic
914447871 1:147765419-147765441 TGATGAGCTCCACTCTTGGAGGG - Intronic
914797209 1:150930363-150930385 CTGGCAATTCCACTCTTTGATGG - Intronic
920974316 1:210771343-210771365 TGGCCAGTTCCATTCTTGGAGGG - Intronic
1062889840 10:1049602-1049624 TGGGGTGTTCCACGCTATGTTGG + Exonic
1066366378 10:34780967-34780989 TTGGGATTTCCTCTATTTGAAGG + Intronic
1068950125 10:62768465-62768487 TGGGGGGTTCTCCTCTTTGATGG - Intergenic
1071963070 10:90824907-90824929 TGGGGAACTCCACTCCCTGAAGG + Intronic
1073538927 10:104302413-104302435 TGTGGAGTTCCCCTCCTTGGAGG + Intronic
1081633787 11:44707242-44707264 GGAAGAGTCCCACTCTTTGAAGG + Intergenic
1085284460 11:75350894-75350916 TGTGGGGTGCCAGTCTTTGAGGG + Intronic
1086484564 11:87284689-87284711 TGGGGAATTTCACTATTTAAAGG + Intronic
1095766969 12:45907124-45907146 TGGGCAGTGCCAGTCTTGGAAGG - Exonic
1100545550 12:95598720-95598742 TGGAGGCTTCCATTCTTTGAAGG + Intergenic
1104596184 12:130121369-130121391 TGGGAAAATCCACTCTTTTATGG + Intergenic
1106759023 13:32849612-32849634 TGAGGACTGCAACTCTTTGAAGG + Intergenic
1109816156 13:67588336-67588358 TGGGGAGTTCCATTCCAAGATGG + Intergenic
1117627056 14:57650953-57650975 TGGGGAATGCCTCTCTTAGAAGG - Intronic
1118112159 14:62733836-62733858 TGGGGAGCACCAGTGTTTGAAGG - Intronic
1118700006 14:68423762-68423784 TGGATCATTCCACTCTTTGAAGG - Intronic
1137230896 16:46566198-46566220 TGGGGAGTTCAACATTTTTAAGG + Intergenic
1137875538 16:51993189-51993211 TAGGAAGATACACTCTTTGATGG + Intergenic
1142094128 16:88230618-88230640 TGGTGCGTTCCACTCTCTGGCGG - Intergenic
1151079953 17:71317574-71317596 TGGGGAAATCCACTCTTAAAGGG - Intergenic
1152261025 17:79267242-79267264 TGGGGAGTCATACTCTTTGGCGG + Intronic
1154279751 18:12991749-12991771 TGGGGACTTCCACCTCTTGAGGG + Intronic
1159247053 18:65819820-65819842 TGGGGAGATTCACGCTGTGAGGG - Intronic
1163823267 19:19508371-19508393 TGGGCTGTTCCACTCTGAGAAGG - Exonic
1167309820 19:48730565-48730587 TGGAAAGGTCCATTCTTTGAGGG - Intronic
925147897 2:1593360-1593382 TGGGGAGTCAGACACTTTGAGGG - Intergenic
925946028 2:8864711-8864733 TGTGCAGATCCACTCTTTCAGGG - Intronic
927229312 2:20804257-20804279 TGGGAAATTCCACACATTGATGG + Intronic
927968492 2:27287895-27287917 TGTGGATTTCCATTTTTTGAGGG + Intronic
938675694 2:133631754-133631776 TGGGGTCTTCCATTCTCTGAAGG + Intergenic
938712490 2:133987656-133987678 TGGAGAATTCCAGTGTTTGATGG - Intergenic
938856579 2:135318367-135318389 TGGGAAGATCCACTGTTTGGGGG + Intronic
940547180 2:155102505-155102527 TGGGGGCTTCCACCCTCTGAAGG + Intergenic
941870226 2:170376689-170376711 TTTGCAGTTCCACTCTTGGACGG + Intronic
948471291 2:238181978-238182000 GGGGAAGTTCTACTCCTTGAAGG + Intronic
948624684 2:239261753-239261775 TGGGCTGGTCCACTCTTAGAAGG + Intronic
1178273155 21:31212225-31212247 TGGGGAGTTCTGCTATTGGAGGG - Intronic
1178474203 21:32922193-32922215 TGGGGATTTCCACTCAAGGATGG + Intergenic
1180556423 22:16581387-16581409 TGGGCAGTTTCAATCTTAGAAGG + Intergenic
1181582419 22:23835578-23835600 TGGGGAGTTCCACTCTTTGATGG - Intronic
950841687 3:15974112-15974134 TGGGCAGTTCTTCTCTTTGGAGG + Intergenic
951299045 3:20972348-20972370 TGGCAAGTCCCACTTTTTGAGGG - Intergenic
954264555 3:49462165-49462187 TTGAGAAATCCACTCTTTGAAGG - Intergenic
955108971 3:55929033-55929055 TGGGGAGTTAACCTCTTTGGTGG + Intronic
965833770 3:172828760-172828782 TGGGGGGTTCTTCTGTTTGATGG - Intergenic
965972097 3:174571926-174571948 TGGGGTTATCCATTCTTTGAAGG - Intronic
966370174 3:179243384-179243406 TGGGCAGTTTCAATCTTAGAAGG + Intronic
966572840 3:181466181-181466203 TGGGGAGTGGCACTCTTTGTTGG - Intergenic
975940251 4:79635192-79635214 TGAGGAGTTCCAATCTGTCAGGG - Intergenic
976845920 4:89489618-89489640 CGGGAAGTTCCACTGTTTGCAGG - Intergenic
981429440 4:144643442-144643464 TGGGCTGTTCCACTCCTTGCTGG + Intergenic
983284171 4:165718313-165718335 TAGGAAATTCCACTATTTGAAGG - Intergenic
989184379 5:38609274-38609296 TAGGGAGTTCCATCCTATGAAGG + Intergenic
990226200 5:53657435-53657457 TGGGGAGTACCTCTCACTGACGG - Intronic
990739279 5:58895696-58895718 TGGAGAGTTCCATTGTTAGACGG - Intergenic
994839127 5:104898579-104898601 TGTAGAGCTCCATTCTTTGAGGG - Intergenic
999503972 5:152176367-152176389 TGGGCCGATCTACTCTTTGATGG + Intergenic
1008766232 6:54918858-54918880 CGGGGAGTTACACCATTTGAGGG - Intronic
1008903653 6:56652368-56652390 TGGTGAGTACCACTCTTTGAAGG - Intronic
1020135802 7:5587222-5587244 AGGTGAGTTCCTGTCTTTGAAGG + Intergenic
1026045502 7:66903399-66903421 TGGGGGGTTCCACTTTTAGAAGG - Intergenic
1029213718 7:98929926-98929948 TGGGGAGTTCTGCAGTTTGAGGG + Intronic
1029522392 7:101071604-101071626 TTGGGAGTTCACCTCTGTGATGG - Intergenic
1030672879 7:112355900-112355922 TGGGGAGTCACCCACTTTGAAGG + Intergenic
1036727709 8:11234259-11234281 TGGAGAGTTCCTATCTCTGATGG + Intergenic
1039940460 8:42085900-42085922 GGGGCAGTACCACTCTGTGAGGG - Intergenic
1040607638 8:48950290-48950312 TGGGGATGTCCAATCTTTTAAGG + Intergenic
1046586854 8:116158121-116158143 TGGGGAGATGCACTGTCTGACGG - Intergenic
1046783066 8:118236397-118236419 TGGTGAGTGCCACTCTTTCACGG - Intronic
1051484833 9:17596941-17596963 TGGGGCCTGCCACTCTTTGATGG + Intronic
1054857164 9:69913583-69913605 AGGGGAGCTCCACTCTTCCAAGG - Intergenic
1055557699 9:77491632-77491654 TTGGGAGTTCCAATGTTGGATGG - Intronic
1059616021 9:115951512-115951534 TGGGGAGTCCCATTATTTGCTGG - Intergenic
1060677479 9:125528499-125528521 TTGGGAGTTCCCCTCCTAGAGGG - Intronic
1062516819 9:136941006-136941028 TGGGGAGCGCCAGGCTTTGATGG + Exonic
1188665048 X:32809000-32809022 TGGGGAGATCCTCTGTTGGATGG - Intronic