ID: 1181582644

View in Genome Browser
Species Human (GRCh38)
Location 22:23836750-23836772
Sequence TATTCAGGTGGGCCCTTGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 112}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181582640_1181582644 2 Left 1181582640 22:23836725-23836747 CCAAGAGACTGCAGCTCATTCTG 0: 1
1: 0
2: 1
3: 17
4: 217
Right 1181582644 22:23836750-23836772 TATTCAGGTGGGCCCTTGCATGG 0: 1
1: 0
2: 1
3: 6
4: 112
1181582639_1181582644 15 Left 1181582639 22:23836712-23836734 CCAGTGCTGTGGGCCAAGAGACT 0: 1
1: 0
2: 3
3: 15
4: 155
Right 1181582644 22:23836750-23836772 TATTCAGGTGGGCCCTTGCATGG 0: 1
1: 0
2: 1
3: 6
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181582644 Original CRISPR TATTCAGGTGGGCCCTTGCA TGG Intronic
900679375 1:3907937-3907959 TTCTCAGGTGGGGCTTTGCAGGG + Intergenic
901925667 1:12564717-12564739 TATTCAGGAGAGGCCTTCCAGGG - Intergenic
902164250 1:14556866-14556888 TATTCCCGAGGACCCTTGCATGG + Intergenic
902607830 1:17578903-17578925 TATGCAAGTTGGCCCATGCATGG + Intronic
902738001 1:18413975-18413997 CCGTGAGGTGGGCCCTTGCAGGG + Intergenic
906726829 1:48050338-48050360 TGATCAGGTGGGGCTTTGCAGGG - Intergenic
908445451 1:64195612-64195634 TAATCAGGTGAGCCCTTAAATGG - Intergenic
909150872 1:72003022-72003044 TATTCAGATGGGCACTTTCAAGG + Intronic
912617399 1:111117606-111117628 GATTCATGTGGGCTCTTCCATGG - Exonic
916262171 1:162852976-162852998 TATTCATGTTGGCCCAGGCATGG + Intronic
916901655 1:169231091-169231113 TATTCAAGAAGGCCTTTGCAAGG - Intronic
918480461 1:184972560-184972582 TATTCAGGAGGGCACTTGCAAGG - Intronic
922368210 1:224885756-224885778 TGCTCAGGTGGTCTCTTGCATGG + Intergenic
1064932025 10:20639060-20639082 TGTTCAGGTGAACCATTGCAGGG + Intergenic
1067146449 10:43697500-43697522 TGATCAGGTGAGCCCTTACAAGG - Intergenic
1067249110 10:44572358-44572380 CCTTCAGGTGGGCCTTTGCCCGG + Intergenic
1069985567 10:72280639-72280661 TTCTCAGCTGGGCCCCTGCATGG - Intergenic
1073126190 10:101151355-101151377 TTTTCTGGAGTGCCCTTGCAAGG - Intergenic
1074238529 10:111611114-111611136 TATTTAAGGGGGCCCATGCAGGG - Intergenic
1083336268 11:61923601-61923623 TGTGCAGGTGGGCCCTTCCTTGG + Intergenic
1092760010 12:11801514-11801536 TAGTCAGGTATGCCCTTGGAGGG - Intronic
1093169291 12:15841396-15841418 TAATCAGGTGAGCCTTTGAAAGG + Intronic
1095380776 12:41588845-41588867 TATCCAGGTGTACCCTTGCTGGG - Intergenic
1101579213 12:106026831-106026853 TGTTCAGGTGGGCCACTGCAAGG + Intergenic
1106468681 13:30035836-30035858 AATTCAGGTGGGCCAGAGCATGG - Intergenic
1113272480 13:108688705-108688727 TATGCAGGTGGGCATTTGAAGGG + Intronic
1113761119 13:112847149-112847171 TAGTGAGCTGGGCACTTGCAGGG + Intronic
1116444247 14:44990189-44990211 TAGTCAGGTGGCACCTGGCAGGG - Intronic
1118877496 14:69797511-69797533 GATTCAGGTGGGCCCTGGGCAGG - Intergenic
1119421994 14:74512692-74512714 TTTTCAGGTGGGTCTCTGCAAGG + Intronic
1121747051 14:96305073-96305095 TATTGAGGTGGGGCATGGCATGG - Intronic
1126031943 15:44507573-44507595 TATTCAGGTAGGCCCTAGAGTGG - Intronic
1127299305 15:57637100-57637122 TATCCAGTTGGGCCCTTCTAAGG - Intronic
1129261831 15:74373062-74373084 TATTCACATGGGCCCTTGGGAGG + Intergenic
1131111965 15:89770134-89770156 TCTTCTGTTGGGCCCTGGCAGGG - Intronic
1138888125 16:61105840-61105862 TCGTCAGGTGAGCCCTTCCAAGG - Intergenic
1139673092 16:68505029-68505051 TTGCCAGGTGTGCCCTTGCAGGG + Intergenic
1142502880 17:343122-343144 TTTGCAAGTGGGACCTTGCAAGG - Intronic
1144848504 17:18232386-18232408 TATTCCAGTGGGCCCCGGCATGG - Intronic
1147891908 17:43723288-43723310 TAATCAGCTGGGAGCTTGCAGGG - Intergenic
1149185198 17:53989540-53989562 GATTCAGGTGGCCCCTTTAAGGG + Intergenic
1150806816 17:68325951-68325973 TATCCAGGTGGGACATTACATGG + Intronic
1163642066 19:18467474-18467496 TGTTCAGGTGTGGCCTGGCATGG - Intronic
1164593653 19:29519820-29519842 TCTTCAGGTGGCCCCTGCCAGGG + Intergenic
1165716074 19:38046621-38046643 GATTCATGTGGGCTCTTGCTGGG - Intronic
926118734 2:10229472-10229494 GATTCAAGTGGGGCCTTGCTGGG + Intergenic
926166708 2:10525633-10525655 TCTCCAGGTGAGCCCCTGCAAGG + Intergenic
928065474 2:28160303-28160325 TTTTTAGCTGGGCCCGTGCATGG + Intronic
932849263 2:75168383-75168405 TAATCAGGTGGGGCCTTAAAAGG + Intronic
934955101 2:98610575-98610597 TCCTGAGGTGGGCCCTTGCCAGG - Intronic
935121107 2:100184450-100184472 TATTGTGCTGGGCCCTGGCATGG + Intergenic
940035167 2:149305086-149305108 TATTCAGGAGTGCCCTGGCCTGG - Intergenic
942771549 2:179526744-179526766 CATTCAGGTGGACCCTTGTCAGG - Intronic
944474739 2:200092207-200092229 TATTCACATGGGTCCTTCCATGG - Intergenic
945999546 2:216469741-216469763 TATTCAGGCATGCTCTTGCATGG + Intronic
948600899 2:239106973-239106995 TCTACTGGTGGGCCCTGGCATGG + Intronic
1170663506 20:18364949-18364971 TAATCAGGTGAGCCCTTTAAAGG - Intergenic
1173249960 20:41359098-41359120 TTGTCATCTGGGCCCTTGCAGGG + Exonic
1173581099 20:44147165-44147187 AATTCACGTGGGCCTTTGCAAGG - Intronic
1173886260 20:46461863-46461885 TCTTCAGTTGGGCCCTTGCCCGG - Intergenic
1178951095 21:36986360-36986382 CATTCAGGTGGGCGCTTACTGGG - Intronic
1181582644 22:23836750-23836772 TATTCAGGTGGGCCCTTGCATGG + Intronic
1183354198 22:37349653-37349675 GGTGCAGGTGGGGCCTTGCAGGG + Intergenic
1184888991 22:47368127-47368149 TAAACAGGTGAGGCCTTGCAGGG - Intergenic
1185410338 22:50678378-50678400 CACTCGGGTGGGCCCATGCACGG - Intergenic
952610493 3:35203139-35203161 TATTTATGTGGGCCTTAGCATGG + Intergenic
953710178 3:45263428-45263450 GATTCTGGTGGGCCACTGCATGG + Intergenic
953835954 3:46344323-46344345 CCTTCAGGTGGGCCTTTGCCTGG + Intergenic
955581409 3:60427074-60427096 TATTCAGGTGAGCCATTTTAAGG + Intronic
955726242 3:61935937-61935959 TATTAAGGTGTGGCCTTGGATGG + Intronic
957480775 3:80790469-80790491 TAATCAGGTGAGCCCTTAAATGG - Intergenic
960607633 3:119524087-119524109 TATTCATGTGGTCCTTTGAAAGG + Exonic
962875494 3:139533135-139533157 CATTCAGCTGGGCCCTTTCCAGG - Intronic
967028739 3:185586476-185586498 TCTTCAGGAGGGCCCGGGCAGGG - Exonic
968597270 4:1491924-1491946 TACTCAGGTGGGCCCTGGAGGGG - Intergenic
969594592 4:8141941-8141963 TTTTCTGGTGGGCTCCTGCATGG - Intronic
970515499 4:16825463-16825485 AATTCATGTGGGTCTTTGCAAGG + Intronic
971361374 4:25941307-25941329 TAGTCAGGTGAGCCCTTCAAAGG + Intergenic
975812626 4:78184753-78184775 TAATCAGGTGGGCCTTTATAAGG - Intronic
976106702 4:81627017-81627039 TAATCAGGTGAGCCCTTAAAAGG + Intronic
977835764 4:101644714-101644736 TATACAGCTGGGCCTTTGCCAGG + Intronic
980114140 4:128663213-128663235 TATTCAGCTGGGAGCTTGCCTGG + Intergenic
980802376 4:137769053-137769075 TAGTCATGTGAGACCTTGCAAGG + Intergenic
982097428 4:151935593-151935615 TAATCATGGGGGCCCTTGCAGGG + Intergenic
985229044 4:187795489-187795511 TATTAAGTTGGGTCCTTGCCTGG - Intergenic
985928273 5:3034812-3034834 TATGAAGATGGGCCCTTGCTAGG + Intergenic
985928290 5:3034887-3034909 TATGAAGATGGGCCCTTGCTAGG + Intergenic
990425285 5:55682126-55682148 TATTCAGATGCTCCCTGGCATGG - Intronic
995831814 5:116362194-116362216 TAGTCAGGTTGGGCCTTGAAAGG + Intronic
997605263 5:135170702-135170724 TAGTCAGGTGGGCCCCTGGCAGG + Intronic
1002536052 5:179876124-179876146 AGATCATGTGGGCCCTTGCAGGG - Intronic
1005845965 6:29778884-29778906 TAATCAGGTGAGCCCATGAAAGG + Intergenic
1005858752 6:29885384-29885406 TAATCAGGTGAGACCTTGAAAGG + Intergenic
1005863893 6:29923920-29923942 TAATCAGGTGAGTCCTTGAAAGG + Intergenic
1005866302 6:29940207-29940229 TAATCAGGTGAGTCCTTGAAAGG + Intergenic
1006249997 6:32775462-32775484 TAATTAGGTGAGCCCTTGAAAGG - Intergenic
1008884339 6:56415899-56415921 TTTTCAGGTGGGCCACTTCAAGG - Intergenic
1014248378 6:119091885-119091907 AATACAGTTGGGGCCTTGCATGG + Intronic
1019534793 7:1523323-1523345 TGTTCAGGTGGAGCCTTCCAAGG + Intergenic
1023092231 7:36628063-36628085 TAGGCAGGTGTGCCCTTCCATGG - Intronic
1023103292 7:36740178-36740200 TATTGAGATTGGCCCTTACAGGG - Intergenic
1025256429 7:57386632-57386654 CCTTCATGTGGGCCCTGGCAGGG - Intergenic
1026438162 7:70417930-70417952 TTTTCAGGTGGTGCCTTGGAAGG - Intronic
1028604791 7:92644014-92644036 TGTTCACGTGGACCCTTACAGGG + Intronic
1028845788 7:95478465-95478487 AATTCAGGTGGGCCAGTGCTTGG + Intronic
1029882522 7:103831244-103831266 TATTCATATTGGCACTTGCAAGG - Intronic
1039899062 8:41737533-41737555 TACTCAGGCGGCCCCTTGCATGG - Intronic
1040006686 8:42627044-42627066 TCTTCAGGTGGGTCCGGGCATGG - Intergenic
1040283955 8:46090035-46090057 TATTAAGGTGTGCCTTTGGAGGG - Intergenic
1042411555 8:68472393-68472415 TAATCAGGTGTGCCCTTTAAAGG - Intronic
1043221227 8:77667509-77667531 TAATGAGGTGTGCCCTTCCAAGG - Intergenic
1045545035 8:103121118-103121140 TATGCAGGTGATCCCTTGCTGGG - Intergenic
1049741287 8:144242210-144242232 GATTCAGGTGGTGCCGTGCACGG + Intronic
1050590285 9:7153564-7153586 TTTGCAGCTGGGCCTTTGCATGG + Intergenic
1052438139 9:28457242-28457264 TATATAGTTGGTCCCTTGCAAGG - Intronic
1059522680 9:114958272-114958294 TTTTCAGAAGTGCCCTTGCAGGG + Intergenic
1185449790 X:276017-276039 TGGTCAGAGGGGCCCTTGCAGGG - Intergenic
1186977666 X:14925291-14925313 TAATCAGGTGAGCCCTTAAAAGG - Intergenic
1190533021 X:51399283-51399305 TAATCAGGTGAGCACTTACAAGG + Intergenic
1198375872 X:136039578-136039600 AATTCAGCTGGCCTCTTGCATGG - Intronic