ID: 1181583260

View in Genome Browser
Species Human (GRCh38)
Location 22:23839310-23839332
Sequence GACCCACGACACCACGGGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181583250_1181583260 29 Left 1181583250 22:23839258-23839280 CCAATGAGGAACTGGTCATTTCG No data
Right 1181583260 22:23839310-23839332 GACCCACGACACCACGGGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181583260 Original CRISPR GACCCACGACACCACGGGGG CGG Intergenic
No off target data available for this crispr