ID: 1181583582

View in Genome Browser
Species Human (GRCh38)
Location 22:23841199-23841221
Sequence GGCTCGTGGGGAGAAGGTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181583569_1181583582 25 Left 1181583569 22:23841151-23841173 CCTGAGCCGCAGAGTGGTTGGAT No data
Right 1181583582 22:23841199-23841221 GGCTCGTGGGGAGAAGGTGAGGG No data
1181583572_1181583582 19 Left 1181583572 22:23841157-23841179 CCGCAGAGTGGTTGGATGGTGGT No data
Right 1181583582 22:23841199-23841221 GGCTCGTGGGGAGAAGGTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181583582 Original CRISPR GGCTCGTGGGGAGAAGGTGA GGG Intergenic
No off target data available for this crispr