ID: 1181583795

View in Genome Browser
Species Human (GRCh38)
Location 22:23842136-23842158
Sequence AGGGCCTCTGACGCCTGGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181583779_1181583795 16 Left 1181583779 22:23842097-23842119 CCACCCTGGCAGCCACAGTGTGC No data
Right 1181583795 22:23842136-23842158 AGGGCCTCTGACGCCTGGGCGGG No data
1181583786_1181583795 4 Left 1181583786 22:23842109-23842131 CCACAGTGTGCAGCAGGGCGGGG No data
Right 1181583795 22:23842136-23842158 AGGGCCTCTGACGCCTGGGCGGG No data
1181583781_1181583795 12 Left 1181583781 22:23842101-23842123 CCTGGCAGCCACAGTGTGCAGCA No data
Right 1181583795 22:23842136-23842158 AGGGCCTCTGACGCCTGGGCGGG No data
1181583780_1181583795 13 Left 1181583780 22:23842100-23842122 CCCTGGCAGCCACAGTGTGCAGC No data
Right 1181583795 22:23842136-23842158 AGGGCCTCTGACGCCTGGGCGGG No data
1181583778_1181583795 17 Left 1181583778 22:23842096-23842118 CCCACCCTGGCAGCCACAGTGTG No data
Right 1181583795 22:23842136-23842158 AGGGCCTCTGACGCCTGGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181583795 Original CRISPR AGGGCCTCTGACGCCTGGGC GGG Intergenic