ID: 1181586903

View in Genome Browser
Species Human (GRCh38)
Location 22:23857585-23857607
Sequence TGGGGGGGAGTCGCCGCCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 104}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181586903 Original CRISPR TGGGGGGGAGTCGCCGCCGC GGG (reversed) Intronic
901822250 1:11837630-11837652 AGGGGAGGAGTCGCCACAGCCGG + Intronic
905066827 1:35192043-35192065 GGCGGGGGATTGGCCGCCGCCGG - Intronic
905414443 1:37794607-37794629 TGGGGGGCTGTGGCGGCCGCGGG - Exonic
913250695 1:116910175-116910197 AGGGGGAGAGTCGCTCCCGCCGG + Exonic
914043862 1:144076439-144076461 TGGGGGGGGGAAGCCGCGGCGGG - Intergenic
915616910 1:157046000-157046022 TCGGCGGGAGTCGCGGCCGCGGG - Intergenic
919777724 1:201205194-201205216 TGGGGTGGAGTAGCCGGTGCCGG - Exonic
919780175 1:201216354-201216376 TGGGGGGGAGTCGGGGTGGCGGG + Intronic
921206998 1:212858016-212858038 TGGGCGGGAGGCGGCCCCGCGGG - Intergenic
1063676025 10:8141245-8141267 TGAGGGAGAGTGGCCTCCGCTGG + Intergenic
1066758086 10:38730395-38730417 TATGGGGCAGTCGCCGCCTCCGG + Intergenic
1066963604 10:42242298-42242320 TATGGAGCAGTCGCCGCCGCCGG - Intergenic
1072930672 10:99659473-99659495 TGGGGACGTGGCGCCGCCGCCGG + Intergenic
1076896064 10:133312884-133312906 TGGGGGGCAGTCACCACTGCTGG + Exonic
1077076879 11:706060-706082 TGGGATGGAGGCGCCCCCGCCGG - Intronic
1077168420 11:1153935-1153957 TGGGGGGAAGTCACCCCAGCTGG + Intergenic
1081872419 11:46389529-46389551 GGGGAGCGAGCCGCCGCCGCCGG + Intergenic
1083342521 11:61967750-61967772 TGTGGGGGAGGGGCGGCCGCTGG + Intergenic
1084694117 11:70743856-70743878 TGTGGGGGTGTCGCAGCAGCCGG - Intronic
1089713737 11:120336522-120336544 CGGGGAGGAGCCGCCGCCTCTGG + Intergenic
1090299936 11:125626345-125626367 TTGGGAGGAGGCGCTGCCGCAGG + Intronic
1090636164 11:128691903-128691925 TGGGGGGCAGTCGCCACCTGTGG + Intronic
1091874292 12:3920757-3920779 TGGGGCGCTGCCGCCGCCGCCGG - Intergenic
1097036764 12:56129334-56129356 TGCGGGGGAGTGTGCGCCGCGGG - Intronic
1097063012 12:56300076-56300098 TGGGAGGGAGACCCCGGCGCCGG + Intronic
1103407455 12:120686353-120686375 CTGGCGGGAGTCGCCGCCGGCGG - Intergenic
1107060543 13:36155106-36155128 CCGGGGGAAGGCGCCGCCGCAGG - Intergenic
1108521619 13:51251628-51251650 TGGGGGGCTTCCGCCGCCGCCGG - Exonic
1113480347 13:110615807-110615829 CGGGGGGGAAGCGCCGCCGAGGG + Intronic
1120953109 14:90060722-90060744 CAGGGTGGAGTCGCCGCAGCTGG + Intergenic
1121439718 14:93941053-93941075 TGGGTGGGAGTGGCCGGAGCAGG + Intronic
1122793256 14:104193329-104193351 TGGGGGGGAGTGGCCGGGGTGGG - Intergenic
1125534714 15:40436473-40436495 TGGGGGAGGGTCGACGCTGCCGG - Intergenic
1125685104 15:41559239-41559261 TGGTGCGGCGTCGCCGCCGATGG + Exonic
1129382815 15:75178576-75178598 CGGGGTGGAGTCGCGGCCACCGG - Intergenic
1130859475 15:87873898-87873920 TGGGGGGCAGTTGCCGCTGAAGG - Intronic
1132251964 15:100341290-100341312 TGCGGGGGCGTCGCCGCCGTCGG + Exonic
1133057042 16:3150494-3150516 TGGGTGGAAACCGCCGCCGCGGG - Intergenic
1136239724 16:28936718-28936740 TGGGCGGGACTCCCCGCCCCGGG - Intronic
1136724757 16:32348791-32348813 TGTGGAGCAGTCGCCGCTGCCGG - Intergenic
1136838093 16:33516672-33516694 TATGGAGCAGTCGCCGCCGCTGG - Intergenic
1136843083 16:33554831-33554853 TGTGGAGCAGTCGCCGCTGCCGG - Intergenic
1137454790 16:48610006-48610028 TGAGGGGGCGTCGCCGCCGCCGG - Exonic
1142032260 16:87844452-87844474 TGGAGGGGAGACTCCGCCGGTGG + Intronic
1142130752 16:88430545-88430567 TGGGGGGCAGCCGGCGGCGCCGG - Exonic
1142300878 16:89257232-89257254 TGGTGGGGGGTGGCCGCCTCCGG + Intergenic
1203001673 16_KI270728v1_random:168964-168986 TGTGGAGCAGTCGCCGCTGCCGG + Intergenic
1203133277 16_KI270728v1_random:1705370-1705392 TGTGGAGCAGTCGCCGCTGCCGG + Intergenic
1203148266 16_KI270728v1_random:1816952-1816974 TATGGAGCAGTCGCCGCCGCTGG - Intergenic
1203153248 16_KI270728v1_random:1855129-1855151 TGTGGAGCAGTCGCCGCTGCCGG - Intergenic
1142683061 17:1561825-1561847 TGGGGAGGAGTGGCCGCCTTAGG - Intronic
1147648886 17:42050730-42050752 TGGGCGGGAGGCGCCGCAGGTGG - Intronic
1147719804 17:42532121-42532143 TGGAGAGGCGCCGCCGCCGCCGG + Intergenic
1149685369 17:58531829-58531851 AGGGTGGGAGGCGCCGTCGCCGG - Intronic
1151237850 17:72734516-72734538 TGGGGTGGAGTCGGGGCAGCAGG - Intronic
1151565132 17:74893457-74893479 TGGGGGCGAGGCGCTGCTGCGGG - Exonic
1152467821 17:80475833-80475855 CTGGGGCGAGTGGCCGCCGCGGG + Intronic
1152654831 17:81514664-81514686 CGGGGAGGGGACGCCGCCGCGGG + Intronic
1160694213 19:474718-474740 TGGGGTGGAGTCGCAGCTGAGGG + Exonic
1162315615 19:9936494-9936516 TGGGGCGGAATCCCGGCCGCCGG - Exonic
1163008003 19:14408298-14408320 TGGGGTGGAGTCGGAGCCACTGG + Exonic
1163847041 19:19643653-19643675 TGCGGGGGCGTGGCCTCCGCTGG - Exonic
1164965977 19:32484440-32484462 TGGCGGGGAGCTGCTGCCGCGGG - Exonic
1165780871 19:38433641-38433663 TGGGAGGAAGTCCCCGCCCCCGG - Intergenic
1166297991 19:41897978-41898000 TGCGGGTGAGTGACCGCCGCCGG + Intronic
1166749660 19:45158885-45158907 TGGGGCAGAGCCGCTGCCGCAGG + Exonic
1167643619 19:50694830-50694852 CGGGGGAGGGTCGCCACCGCGGG + Intronic
932036562 2:68252260-68252282 GGGAGGGGAGGCGGCGCCGCGGG + Exonic
935698178 2:105787659-105787681 TGGGGTGGAGTCTCCACCGCAGG - Intronic
944221724 2:197310404-197310426 CGGAGGGGAGCTGCCGCCGCGGG + Intronic
946247473 2:218396025-218396047 GGCGTGGGAGTCGCGGCCGCCGG - Exonic
949004450 2:241637296-241637318 GGCGGGGGAGTCGCCCCGGCGGG + Exonic
1168851143 20:977955-977977 TGGGAGGCAGTCGCCACTGCTGG + Intronic
1172994379 20:39059231-39059253 TGGGGGAGATACGCAGCCGCAGG - Intergenic
1176169526 20:63690653-63690675 TTGGGGGGAGTCTCAGCCTCGGG - Intronic
1178843579 21:36156793-36156815 TGGGGAAGAGCCGCTGCCGCTGG + Intronic
1181586903 22:23857585-23857607 TGGGGGGGAGTCGCCGCCGCGGG - Intronic
1183093755 22:35540486-35540508 TGGGGGGCAGACGCTGGCGCTGG + Intergenic
950125029 3:10505615-10505637 GGGGGCGGAGGCGCCGGCGCCGG + Intronic
961868940 3:129974636-129974658 CGGGGAGGGGTCGCGGCCGCCGG - Exonic
966915659 3:184583012-184583034 TGGGTGGGAATCACAGCCGCGGG - Intronic
968533972 4:1112711-1112733 TGGAGGGGAGGGGCCGCCGGGGG - Intronic
979565796 4:122152694-122152716 TATGAAGGAGTCGCCGCCGCAGG - Intronic
983649743 4:170026340-170026362 TGCGGGCGAGCCGCCTCCGCCGG + Exonic
985542914 5:495094-495116 TGGGGGGGCGCCGTGGCCGCAGG + Intronic
986079897 5:4379408-4379430 TGCGGGGGAGTTACCGCCACAGG - Intergenic
987050763 5:14144775-14144797 GCGGGAGGAGGCGCCGCCGCTGG - Intronic
995512391 5:112922045-112922067 TGGCCGGGGGTCGCCGCCGCTGG - Intronic
997965423 5:138352678-138352700 TGGGGGGGAACGGCGGCCGCGGG + Exonic
998192856 5:140042236-140042258 TGGGGGGGTGGGGCCGCCCCTGG - Intronic
1002792584 6:446939-446961 TGGGGGGCGGTGCCCGCCGCCGG + Intergenic
1003325086 6:5085185-5085207 GGGCGGGGAGGCGCGGCCGCTGG - Exonic
1013230562 6:108158010-108158032 CGGGGGGGCGGCGCGGCCGCGGG - Intronic
1014098182 6:117482597-117482619 CGGGCGGGAGACGCCCCCGCAGG + Intronic
1014798303 6:125749579-125749601 GGGGGGGGCGTGGCCGGCGCCGG + Exonic
1024226142 7:47328104-47328126 TGGGTGGGGGACGCCACCGCTGG - Intronic
1024262041 7:47580590-47580612 GGGTGGGGAGTCGCTGCAGCTGG - Intronic
1025007034 7:55363226-55363248 TGGTGGGGAGCCGCCGCAGGCGG + Intergenic
1030121102 7:106111945-106111967 CGGGGCGGAGACGCCGCGGCGGG - Intronic
1035352695 7:158257717-158257739 GCGGGGGCAGTCACCGCCGCAGG - Intronic
1035476191 7:159145303-159145325 TGGGGGAGAGCGGCCGGCGCGGG + Intergenic
1035752130 8:2003142-2003164 TGGTGGGGAGTCGGGGCCGCTGG + Exonic
1039454320 8:37697383-37697405 TTTGCGGGAGTCGCCGCCGCCGG - Exonic
1041044323 8:53877346-53877368 TGGGGCGCAGACGCGGCCGCCGG + Intronic
1043388198 8:79768139-79768161 CGGGGAGGAGCCGCGGCCGCCGG - Intergenic
1045815163 8:106270303-106270325 AGGGGCGCACTCGCCGCCGCGGG + Intronic
1053129038 9:35605179-35605201 TGAGGGGGCGTGGCCGCTGCCGG + Intergenic
1057214902 9:93222477-93222499 TGGGGGTGAGTCGGCGGCACTGG - Intronic
1057787094 9:98095547-98095569 TGAGGGGGTGTGGCCACCGCAGG + Intronic
1062596472 9:137302083-137302105 GGGCCGGGGGTCGCCGCCGCGGG + Exonic
1187067308 X:15854254-15854276 TGGGGGGGAGGCACCGGCGACGG - Intronic
1192233155 X:69279462-69279484 TGGGGGGGGGTGGCCACAGCTGG + Intergenic