ID: 1181590536

View in Genome Browser
Species Human (GRCh38)
Location 22:23882481-23882503
Sequence CGGGGACTTGGCAGGGGAGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 424
Summary {0: 1, 1: 0, 2: 4, 3: 25, 4: 394}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181590520_1181590536 13 Left 1181590520 22:23882445-23882467 CCTCCCTGGCTCAGCACTACGGC 0: 1
1: 0
2: 0
3: 9
4: 142
Right 1181590536 22:23882481-23882503 CGGGGACTTGGCAGGGGAGCTGG 0: 1
1: 0
2: 4
3: 25
4: 394
1181590518_1181590536 16 Left 1181590518 22:23882442-23882464 CCTCCTCCCTGGCTCAGCACTAC 0: 1
1: 0
2: 3
3: 36
4: 344
Right 1181590536 22:23882481-23882503 CGGGGACTTGGCAGGGGAGCTGG 0: 1
1: 0
2: 4
3: 25
4: 394
1181590523_1181590536 9 Left 1181590523 22:23882449-23882471 CCTGGCTCAGCACTACGGCGGCT 0: 1
1: 0
2: 1
3: 6
4: 65
Right 1181590536 22:23882481-23882503 CGGGGACTTGGCAGGGGAGCTGG 0: 1
1: 0
2: 4
3: 25
4: 394
1181590522_1181590536 10 Left 1181590522 22:23882448-23882470 CCCTGGCTCAGCACTACGGCGGC 0: 1
1: 0
2: 0
3: 6
4: 66
Right 1181590536 22:23882481-23882503 CGGGGACTTGGCAGGGGAGCTGG 0: 1
1: 0
2: 4
3: 25
4: 394
1181590517_1181590536 17 Left 1181590517 22:23882441-23882463 CCCTCCTCCCTGGCTCAGCACTA 0: 1
1: 0
2: 4
3: 39
4: 345
Right 1181590536 22:23882481-23882503 CGGGGACTTGGCAGGGGAGCTGG 0: 1
1: 0
2: 4
3: 25
4: 394

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181590536 Original CRISPR CGGGGACTTGGCAGGGGAGC TGG Exonic
900132186 1:1091867-1091889 CAGGGCCGTGGCAGGGGTGCAGG + Intronic
900244547 1:1631218-1631240 GGGGGATTGGGCAGAGGAGCAGG - Intergenic
900283951 1:1890600-1890622 CGGGGTCTAGGGAGAGGAGCCGG - Intronic
900714882 1:4137925-4137947 CAGGGCCTGGGCAGAGGAGCTGG - Intergenic
900923924 1:5691335-5691357 CGGGGACTTGGGGTGGGAGAGGG + Intergenic
900929166 1:5725584-5725606 AGAGCACTTGGCAGGGGACCTGG + Intergenic
901631910 1:10652145-10652167 CCAGTGCTTGGCAGGGGAGCTGG - Intronic
901978291 1:13012653-13012675 GGGGAACGTGGCAGGAGAGCAGG + Intronic
902003793 1:13216285-13216307 GGGGAACGTGGCAGGAGAGCAGG - Intergenic
902645929 1:17797886-17797908 TGGGTACAGGGCAGGGGAGCAGG + Intronic
902759136 1:18569477-18569499 CGGGGACAGGGCAGGAGAGTGGG + Intergenic
903333440 1:22609241-22609263 CGGGGCCTTTGGTGGGGAGCAGG + Intergenic
903379448 1:22886581-22886603 GGGGGAGTTGGCAGTGGAGATGG + Intronic
904225638 1:29015988-29016010 CAGGAAATTGGCAGGGGAACTGG + Intronic
905024038 1:34837692-34837714 CAGGGCCTGAGCAGGGGAGCAGG - Intronic
905037938 1:34929659-34929681 CGGGGACCGGGAAGGGGAGGCGG + Intergenic
905230190 1:36510358-36510380 CGGCCACTTGGCAGGGTGGCTGG - Intergenic
905449368 1:38046895-38046917 CGGGGGCCGGGCAGGGGAGGCGG - Intergenic
906731878 1:48089713-48089735 AGGGGACAGGGCAGGGGAGAAGG - Intergenic
906755004 1:48303428-48303450 CAGGGACTGGGAAGGGGAGGAGG - Intronic
910123742 1:83818274-83818296 CGGGGAAGGGGAAGGGGAGCTGG - Intergenic
910337997 1:86155647-86155669 CGGGGACTGGGGAGGGGAGCAGG - Intronic
911746411 1:101446125-101446147 TGGGGACTTGGCAGGGGGCAGGG - Intergenic
911871883 1:103108745-103108767 CGGGGATTTGGTAGGCGAGGAGG - Intergenic
914753940 1:150552708-150552730 TGGGGAGTTGGCAGGGGAGGTGG - Intronic
915624529 1:157106582-157106604 CGATGACGTGGCAGAGGAGCAGG + Intergenic
916007901 1:160678541-160678563 CAAAGGCTTGGCAGGGGAGCTGG + Intergenic
921070737 1:211655804-211655826 AGGGGGCTGGGGAGGGGAGCGGG - Intergenic
924441838 1:244092683-244092705 AGGAGACTTGGCAGGGAAGGAGG - Intergenic
1064645213 10:17453762-17453784 TGGGGACCTGGCCTGGGAGCCGG - Intronic
1067048850 10:43000690-43000712 AGGGGACGGGGCTGGGGAGCTGG + Intergenic
1067560203 10:47300113-47300135 CGGGCTCTCGGCTGGGGAGCGGG + Intergenic
1069825645 10:71253613-71253635 AGGGAGCTTGGCAGGGGAGAGGG - Intronic
1069916518 10:71790213-71790235 CCGGGACAGGGCAGGGGAGGTGG + Intronic
1070599633 10:77856695-77856717 TGGGGCCTGGGCAGGGGAGACGG + Intronic
1070796719 10:79221193-79221215 CGGGGCTTTGTCAGGAGAGCTGG + Intronic
1070815085 10:79317917-79317939 CAGGAAGTGGGCAGGGGAGCAGG + Intergenic
1071446521 10:85753771-85753793 CGGGGAATAGGAAGGGGAGTGGG + Intronic
1072009439 10:91290737-91290759 GGGGTGCTTGGCAGGGCAGCTGG - Intergenic
1073357552 10:102869458-102869480 CGGGGCCTCGGCACAGGAGCTGG + Intronic
1073535847 10:104275752-104275774 AGGGGACTGGGGAGGGGAGATGG - Intronic
1074082165 10:110176483-110176505 CTGGGACGTGGCTGGGGAGAGGG + Intergenic
1074859607 10:117500319-117500341 GGGTGACTGGGAAGGGGAGCCGG + Intergenic
1075475543 10:122730605-122730627 GGAGGAATTGGCAGGGGAGTAGG - Intergenic
1075527564 10:123199350-123199372 CAGGGACTGGGCAGTGGAGTTGG + Intergenic
1075726571 10:124613597-124613619 CAGGGCCCAGGCAGGGGAGCAGG - Exonic
1076696130 10:132248289-132248311 CTGGGCCGTGGCAGGGGAGATGG + Intronic
1076710705 10:132332243-132332265 CGGGGACGCGGCAGGTGAGACGG + Exonic
1077041680 11:527420-527442 CAGGGGCTGGGGAGGGGAGCTGG - Intergenic
1077166002 11:1139213-1139235 CGGGGTGTAGGCAGGGGAGATGG + Intergenic
1077525339 11:3060853-3060875 CCGGGAGTTGGCAGCAGAGCTGG - Intergenic
1078090170 11:8260092-8260114 GGGGGACTGGGCAGGAGAGGAGG - Intronic
1080159745 11:29159662-29159684 CAGGGACTTCTCAGAGGAGCTGG + Intergenic
1082025109 11:47565815-47565837 CGGGGACGGGGCAGGGGCCCGGG - Intronic
1083897487 11:65627361-65627383 CGGGTGCTTGGTAGGGGACCGGG - Intronic
1084313407 11:68329845-68329867 CGGGGGCTTGGCAAGGCAGGAGG + Intronic
1084615328 11:70231948-70231970 CAGGGCCAGGGCAGGGGAGCAGG - Intergenic
1084786617 11:71445462-71445484 GAGGGCCTTGGCAGGGAAGCTGG - Intronic
1085076343 11:73596579-73596601 AGGGGACTTTGCAGGGGACACGG - Intronic
1086439694 11:86815837-86815859 CAGGGCAGTGGCAGGGGAGCTGG - Intronic
1088359489 11:108975912-108975934 CAAGGACTTGGAAAGGGAGCCGG - Intergenic
1088735666 11:112725794-112725816 CAGGGAGCTTGCAGGGGAGCTGG + Intergenic
1089300031 11:117492991-117493013 TGGGGAGGTGCCAGGGGAGCTGG + Intronic
1089616355 11:119696943-119696965 AGGAGACCTGGCAGGGGAGGAGG + Intronic
1089858907 11:121571646-121571668 GGGTGAAGTGGCAGGGGAGCCGG - Intronic
1090244378 11:125205290-125205312 CGGGGAGGTGGGTGGGGAGCGGG + Intronic
1091269027 11:134292735-134292757 CCGGGAGTGAGCAGGGGAGCGGG + Intronic
1091387471 12:103879-103901 CGGGGGCTCGGGAGGGGAGGCGG + Intronic
1091446808 12:548355-548377 GGGGGATTTGGCAGGGGAGGAGG + Intronic
1092125472 12:6072269-6072291 GGGGGACTGGGGAGGGAAGCTGG - Intronic
1092382918 12:8012538-8012560 GGGGGAGTTGGGTGGGGAGCTGG + Intergenic
1093464853 12:19439394-19439416 CGGGCACTGGGCAGCGGGGCGGG + Intronic
1094472491 12:30816792-30816814 CTGGGAGCTGGGAGGGGAGCAGG + Intergenic
1094599728 12:31898135-31898157 AGGGGAATTGGCAGGGGAGCAGG - Intergenic
1096259331 12:50081231-50081253 CGGGGACGGGGCAGGTGGGCGGG - Intronic
1096513189 12:52143213-52143235 AAGGGACATGGCAGGGAAGCGGG - Intergenic
1096722266 12:53532210-53532232 GGGCGAGTGGGCAGGGGAGCTGG - Intronic
1096973311 12:55684446-55684468 GGGGGGCTTGGCAGGGATGCAGG - Exonic
1097029170 12:56079525-56079547 CGGGGATTTGGATGGGGGGCGGG - Intergenic
1097264830 12:57738756-57738778 CGGGGGATTCGCAGGGGCGCGGG + Intronic
1098527651 12:71504648-71504670 CGGAGACTGGGCAGGGGATTCGG - Exonic
1101364954 12:104063101-104063123 CACGGACTTGGCAGGGGAGTGGG - Intronic
1102031474 12:109742337-109742359 CGGGGACTTGGAATGTGAGCAGG - Intronic
1102201206 12:111059251-111059273 CGGGGAGGTGGGAGGGGAGGAGG + Intronic
1102246980 12:111362170-111362192 CCGGGACCTGCCAGAGGAGCTGG - Exonic
1102991374 12:117318697-117318719 CGAGGACCTGAGAGGGGAGCAGG + Intronic
1103080509 12:118020166-118020188 AGGGGCCTTGGCAGGGGTGGGGG + Intronic
1103363226 12:120366358-120366380 GTGGGACTTGGCAGGAGAGGAGG - Intronic
1103464263 12:121129153-121129175 CTGGAACTGGGCAGGGGATCTGG + Intergenic
1103649585 12:122422455-122422477 CGGGAAGCCGGCAGGGGAGCAGG + Intronic
1103739380 12:123081154-123081176 CAGTGTCTGGGCAGGGGAGCAGG + Intronic
1103748383 12:123141791-123141813 TGGGGTGTTGGCAGTGGAGCGGG - Intronic
1105476135 13:20729691-20729713 TGGGGATGTCGCAGGGGAGCTGG - Intronic
1106774078 13:32991552-32991574 CAGGGTATTGGCAGGGGAGGTGG + Intergenic
1107950457 13:45456878-45456900 CAGGGACATGGCAGTGAAGCAGG - Intergenic
1112941778 13:104872222-104872244 GGGGGACGTGGCAGGGGACAAGG - Intergenic
1114880283 14:26776415-26776437 GGGGGACTTGGCAGGGGGTATGG + Intergenic
1115341672 14:32299366-32299388 AGGGGACTTGGGAGGAGAGTAGG - Intergenic
1118732920 14:68681889-68681911 TGGGGACTGGGGAGTGGAGCAGG + Intronic
1119080819 14:71691779-71691801 AGGCGACTTGTCAGAGGAGCAGG - Intronic
1119616302 14:76101186-76101208 CGGGGGGTTGGCAGGAGAGTGGG - Intergenic
1122128561 14:99592295-99592317 CGTGGGTTAGGCAGGGGAGCAGG + Intronic
1122151135 14:99726803-99726825 AGGGGACGGGGCAGGGGAGAAGG - Exonic
1122882695 14:104697125-104697147 TGGGGACTTCACAGGGGAGGGGG + Intronic
1122904721 14:104796323-104796345 GGGGGACTTTGCTGGGGAGTGGG + Intergenic
1122986098 14:105212411-105212433 AGGGGAGTGGGCTGGGGAGCGGG - Intronic
1124855058 15:33379872-33379894 CGGGGGCTTGCCAGGGGCTCTGG - Intronic
1125546133 15:40507111-40507133 GGGGGCCGTGTCAGGGGAGCAGG + Intergenic
1126161635 15:45619475-45619497 TGGGAACTGGGCAAGGGAGCCGG - Intronic
1127426728 15:58865330-58865352 AGGGGAGGAGGCAGGGGAGCGGG + Intronic
1128028794 15:64461203-64461225 CAGGGAGTTGGCGGGGGAGGGGG + Intronic
1128063059 15:64747411-64747433 CTGGGACCTGGCTGGGGAGCAGG - Intronic
1128161632 15:65426457-65426479 TGTGGACTGGGCAGGGGAGCAGG + Intergenic
1128240779 15:66099753-66099775 CCAGGACTGGGCTGGGGAGCTGG + Intronic
1128578482 15:68792150-68792172 CCAGGACTTGGCAGGGGAAGTGG - Intronic
1128665629 15:69536228-69536250 GGGGGACATGGCAGGAGAGGAGG + Intergenic
1128999355 15:72319859-72319881 CGGGGACATGGCCGCGGCGCCGG - Exonic
1130099857 15:80885075-80885097 CTGGGGCTTGGCAGGGGCGAGGG - Intronic
1131059381 15:89395271-89395293 CTGGGACTTGGCAGGGGACCTGG + Intergenic
1131285249 15:91051531-91051553 GGGGGGCATGGCATGGGAGCAGG - Intergenic
1132695630 16:1200601-1200623 CTGGGGCACGGCAGGGGAGCGGG + Intronic
1132852985 16:2033158-2033180 TGGAGCCTTCGCAGGGGAGCGGG + Intronic
1132882374 16:2168125-2168147 CGGGGAGTAGGCAAGGGTGCTGG - Exonic
1132906066 16:2283401-2283423 CGGGAACCTGGAAGGGGAGGAGG - Intronic
1133001534 16:2853876-2853898 CGGCTACTTGGAGGGGGAGCGGG - Exonic
1134012979 16:10868857-10868879 CGGGGAGCTGGGAGGGGTGCAGG + Intergenic
1134022393 16:10930081-10930103 CGGGGACGTGCCAGGGGGCCAGG - Exonic
1135706071 16:24676184-24676206 CAGGGAGTGGGCAGGGGAGAAGG - Intergenic
1136109997 16:28058817-28058839 AGGGGACTGGGCAGAAGAGCTGG + Intronic
1136414682 16:30096042-30096064 CGCGGGCTGGGCAGGGGCGCGGG + Exonic
1136417805 16:30114146-30114168 CAGGGAGGTGGCAGGGGCGCCGG + Exonic
1136551908 16:30986407-30986429 CGGGTACCTGGCAGAGGAGGAGG - Exonic
1137677862 16:50312759-50312781 CGGGGAGTGGGGAGGGGGGCGGG - Intronic
1138051351 16:53782058-53782080 CGGGCACTTGTCTGGGGAGAGGG - Intronic
1138295842 16:55884531-55884553 AGGGGACATGGCAGGAGAGGTGG - Intronic
1139439571 16:66959273-66959295 TGGGGACGTGGGAGGGGACCAGG + Intergenic
1139511603 16:67431196-67431218 CGGGGGCCGGGCCGGGGAGCGGG - Exonic
1139953108 16:70681360-70681382 CAGGGGCCTGGCAGGGGATCTGG + Intronic
1140685297 16:77427777-77427799 CTGTGAGTTGGCAGGGGAGGTGG + Intronic
1141582771 16:85011493-85011515 CGGAGCCTTGGCTGGAGAGCGGG + Exonic
1142670088 17:1484113-1484135 TGGGGAGATGGCAGGGGTGCTGG - Intronic
1142849209 17:2696164-2696186 CAGGGATCTGGCAGGAGAGCAGG + Exonic
1143108153 17:4539655-4539677 TGGGGATTTGGCAGGGGTGCTGG + Exonic
1143554437 17:7651711-7651733 CGGGGACCCGGGAGGGGAGCTGG - Intronic
1144582268 17:16465736-16465758 CGGGGAGACGGCAGGGGAGTGGG - Intronic
1144961152 17:19044888-19044910 TGGAGACTGGGCTGGGGAGCAGG + Intronic
1144974009 17:19129636-19129658 TGGAGACTGGGCTGGGGAGCAGG - Intronic
1145066067 17:19762227-19762249 GGGGGCCTTGGCAGGAAAGCAGG - Intergenic
1146667715 17:34715987-34716009 GGGAGGCTTTGCAGGGGAGCAGG - Intergenic
1146931627 17:36782255-36782277 GAGGGACTGGGTAGGGGAGCTGG - Intergenic
1147670218 17:42172760-42172782 CTGGGAGATGGTAGGGGAGCCGG + Intronic
1147969697 17:44212724-44212746 CGGGCACGGTGCAGGGGAGCAGG - Intronic
1148212065 17:45814627-45814649 CAGGGACTTGGGGGGAGAGCTGG - Intronic
1148473895 17:47914458-47914480 CCAAGACTTGGCAGTGGAGCAGG + Intronic
1148766296 17:50040510-50040532 CTGGGGCTTGGCAGGGGAGAGGG - Intergenic
1149007940 17:51824912-51824934 CGTGGCCTTGGCAGCGGTGCTGG + Intronic
1150292482 17:63989441-63989463 GGGGGACTTGGCTGGGGGGCCGG + Intergenic
1150653956 17:67027437-67027459 TGGGGACTGAGCAGGGCAGCAGG + Intronic
1150765099 17:67996083-67996105 CGGGGCCCTGGGAGCGGAGCGGG - Intergenic
1150869932 17:68895967-68895989 AGGGTACTTGGCAGGGGTGGTGG - Intronic
1151344375 17:73492710-73492732 GGGCCATTTGGCAGGGGAGCTGG - Intronic
1151370237 17:73643124-73643146 CGGGGACCTGCCCGGGGACCAGG + Intronic
1151384667 17:73747716-73747738 AGGGGACTGGGGAGGGGACCGGG + Intergenic
1151399256 17:73844879-73844901 TGTGGACTTGTCAGGAGAGCTGG - Intergenic
1151734332 17:75929622-75929644 AGGGGGCTTGGCAGGGGATGTGG + Intronic
1152038979 17:77891050-77891072 CTGGGAGGTGGCAGGGGAGGAGG - Intergenic
1152130388 17:78472677-78472699 CGGGGACTCGGCTGGGGTCCAGG - Intronic
1152586207 17:81190587-81190609 CGGAGGCGGGGCAGGGGAGCGGG - Intronic
1152863442 17:82709174-82709196 CAGGGACCTGGCATGGGGGCAGG - Intergenic
1152870454 17:82751020-82751042 CGGGGACGGGGCAGGGGGGACGG - Exonic
1152934125 17:83126096-83126118 TGGGGATTTGCCAGGGGAGAAGG + Intergenic
1153339604 18:3960780-3960802 AGGGGGCCTGGCTGGGGAGCAGG - Intronic
1153781235 18:8496376-8496398 TTGGGCCTTGGCAGGAGAGCTGG - Intergenic
1154176893 18:12091872-12091894 CGAGGACTTGGCAGGTCTGCTGG - Intergenic
1156495085 18:37520247-37520269 CTGGGCCTGGCCAGGGGAGCAGG + Intronic
1157519652 18:48336804-48336826 CTTGGACTTGGCTGGGGACCTGG - Intronic
1160742846 19:695305-695327 CGGGGACTTGGCGGGGGCCTGGG + Intronic
1160745351 19:708844-708866 CGGGGAGGTGGGAGGGGAGCGGG + Intergenic
1160758609 19:771586-771608 AGGGGACTGGGCAGAGGAGGAGG - Intergenic
1160758685 19:771810-771832 AGGGGACTGGGCAGAGGAGGAGG - Intergenic
1160758710 19:771879-771901 AGGGGACTGGGCAGAGGAGGAGG - Intergenic
1160758725 19:771929-771951 AGGGGACTGGGCAGAGGAGGAGG - Intergenic
1160758750 19:771998-772020 AGGGGACTGGGCAGAGGAGGAGG - Intergenic
1160758778 19:772089-772111 AGGGGACTGGGCAGAGGAGGGGG - Intergenic
1160774877 19:850811-850833 GGAGGAACTGGCAGGGGAGCTGG - Intergenic
1161065638 19:2236081-2236103 CGGGGTCTGGGCGGGGGTGCCGG - Intronic
1161171636 19:2815196-2815218 CTGGGACTTCGCTGGGGACCAGG - Exonic
1161210218 19:3062041-3062063 CGGGGAGTTGGGGGGGGCGCCGG + Intronic
1161382930 19:3976014-3976036 CGGTGTCTTCGCAGGGGAGCGGG - Intergenic
1161919414 19:7255010-7255032 CGGGGACCGGGGAGGGGGGCCGG - Intronic
1162030517 19:7915324-7915346 TGGGGACAGGGCAGGGGAGTGGG + Intergenic
1163154613 19:15432974-15432996 CGGGGACTGGGCTGGGGCGGCGG - Intronic
1163234772 19:16023882-16023904 GGGTGACTTGGGAGGGGACCTGG - Intergenic
1163686749 19:18716105-18716127 GGGGCACTGGGCAGGGCAGCGGG - Intronic
1163810638 19:19429359-19429381 CGGGGAGTAGGCAGGCGTGCTGG + Intronic
1164617284 19:29674710-29674732 GGGGGCCTGGGCAGTGGAGCTGG - Exonic
1165421919 19:35726355-35726377 TGGGGACCGGGCAGGGGAACTGG + Intronic
1166734297 19:45075498-45075520 GGGGGACTGGGCAGGGAAGGAGG - Intronic
1166762590 19:45234401-45234423 CGGGGGCCTGGCCGGGCAGCTGG - Intronic
1167134664 19:47609489-47609511 CCGGGTCTGGGCAGGGAAGCCGG - Intronic
1167259977 19:48452824-48452846 GTGGGACCTGGCAGTGGAGCGGG + Exonic
1167337588 19:48896312-48896334 TGGGGACTTGGCAGTGGATGGGG - Intronic
1167423044 19:49415008-49415030 TGGGGACTGGGGAGGGGTGCTGG - Intronic
1168152423 19:54456203-54456225 CGGGGACCTGGAGGAGGAGCGGG - Exonic
1168355087 19:55695538-55695560 TGGGGCCTGGGGAGGGGAGCTGG + Intronic
1168362346 19:55752653-55752675 AGGGGACTTGGCGGGGAAGTGGG - Intergenic
1168678138 19:58293976-58293998 AGGGGACTTGCCAGGGCAGCTGG + Intronic
925895289 2:8466683-8466705 CTGGGGCCTGTCAGGGGAGCGGG - Intergenic
926106272 2:10153871-10153893 CAGGGACTGGGGAGGGGAGAAGG + Intronic
926155962 2:10454241-10454263 CTGGCACCTGGCAGGGGCGCTGG - Intergenic
926718551 2:15942492-15942514 CGGGGACTGGGCGGTGGAACCGG - Exonic
926780894 2:16471043-16471065 TGGGGAGTTGTCAGGGGAGGTGG - Intergenic
927204373 2:20597890-20597912 AGAGGGCCTGGCAGGGGAGCCGG + Intronic
927683400 2:25154799-25154821 CAGGGACATGGGCGGGGAGCAGG - Exonic
927991825 2:27453531-27453553 CTGGGACTTGGCATGGTAGGGGG + Intronic
928324836 2:30311176-30311198 AGGGGGCGTGGCAGGGCAGCGGG + Intronic
928531872 2:32200779-32200801 GGGGGACTTGGCAGGGTCACAGG - Intronic
929937391 2:46303486-46303508 TGGGGACATGGAAAGGGAGCTGG + Intronic
930075565 2:47403106-47403128 GGGGGACGTGGGAGGGGAGGCGG + Exonic
930423842 2:51188422-51188444 CTGGGGCCTGTCAGGGGAGCAGG - Intergenic
931009035 2:57886464-57886486 CGGTGGCTTGGCAGGGGAGGTGG + Intergenic
931364446 2:61606664-61606686 CGGGGGGGTGGCGGGGGAGCGGG + Intergenic
935384606 2:102487288-102487310 CTTGGACTTGGCTGGGGAGGTGG + Intronic
936647593 2:114389345-114389367 GGGGAACTTGGCAGGTGAGTGGG - Intergenic
937241749 2:120466382-120466404 CGGGGGCGTGGCTGGGGACCTGG + Intergenic
937878907 2:126850522-126850544 AGGGGATTTGGCACGGGCGCTGG - Intergenic
937904309 2:127045448-127045470 CGGGGAGCTGGCAGGAGGGCGGG + Intergenic
938082002 2:128375013-128375035 CAGGGACATCGCAGGGCAGCTGG + Intergenic
938133140 2:128734390-128734412 GGGGGAGTTGGCAGGGGAGAGGG - Intergenic
938143353 2:128813547-128813569 AGGGGAATGGGCAGGGGAGAGGG - Intergenic
938406937 2:131038033-131038055 CTGGGGCTTGGGATGGGAGCAGG + Intronic
942768239 2:179483209-179483231 CGGGGTCAGGGCAGGGGAACAGG + Intronic
945080700 2:206085001-206085023 CGGGGAGTTGGGTGGGGCGCGGG + Intronic
947564813 2:231186948-231186970 CGGGGGCTTGGAAGGGGATGGGG - Intergenic
948241479 2:236440584-236440606 CTGGGTCTTGACAGCGGAGCAGG + Intronic
948607041 2:239142472-239142494 CTGGGACTTGGCGGGTGAGTGGG - Intronic
948806186 2:240454232-240454254 CAGGGACTGGCCAGGGGCGCAGG + Intronic
948876854 2:240834005-240834027 CGGGGACCTGGGTGTGGAGCAGG + Intergenic
948997605 2:241591291-241591313 CGGGGGCTTGAGAGGGCAGCGGG + Intronic
1170867111 20:20167903-20167925 CAGGGACCTGGCAGAGGATCAGG + Intronic
1171401000 20:24872914-24872936 CTGGGAGGTGGCAGGGGAGGTGG + Intergenic
1172589915 20:36110436-36110458 TGGGGACTGGGCAGGAGAGAAGG - Intronic
1172628127 20:36360471-36360493 CGGGGTCGTGGCAGGTGAACAGG - Intronic
1173679885 20:44870849-44870871 TGGGGACTAGGCAGTGGATCAGG - Intergenic
1173827831 20:46058598-46058620 CGGTGCCTTCGCTGGGGAGCAGG + Intronic
1174349526 20:49956922-49956944 CGGGGACCTGGCCGGGGGGATGG + Intergenic
1175153714 20:56955107-56955129 CGGGGAGTTTGCAGGAGAGCAGG + Intergenic
1175476222 20:59276593-59276615 CTGGGACTGGACAGGGGAGGTGG + Intergenic
1176016184 20:62934340-62934362 CGTGGAGATGCCAGGGGAGCAGG - Intronic
1176146007 20:63565857-63565879 AGGGGACCTGGCCGAGGAGCAGG - Exonic
1176146784 20:63569040-63569062 CGTGGACTTGGCAGCGGGGCTGG - Intronic
1176195684 20:63835567-63835589 TTGGGGCTTGGCAGGGGCGCAGG - Intergenic
1176195977 20:63836442-63836464 CGCGGGCAGGGCAGGGGAGCGGG + Intergenic
1176383553 21:6125944-6125966 GGGGAATCTGGCAGGGGAGCTGG + Intergenic
1176889630 21:14298981-14299003 CTGGGACCTGTCAGGGGAGTGGG - Intergenic
1178664947 21:34538478-34538500 TGGGGAATTGGCTGGGGAGTTGG - Intronic
1179739917 21:43412294-43412316 GGGGAATCTGGCAGGGGAGCTGG - Intergenic
1179820452 21:43934170-43934192 CTGGTGCTCGGCAGGGGAGCTGG - Intronic
1179955744 21:44737216-44737238 TGGGGGCTGGGCAGGTGAGCAGG + Intergenic
1180109898 21:45642968-45642990 CGGGGATTTGGCGGGCGGGCGGG - Intergenic
1180211402 21:46297301-46297323 CGGGGCCTCGGGAGGGGAGTGGG - Intronic
1180850928 22:19019760-19019782 AGAGGTCTCGGCAGGGGAGCAGG + Intergenic
1181027027 22:20132328-20132350 CTGGGCCCTGGCAGGGGAGGAGG + Intronic
1181028854 22:20140537-20140559 AGGGGGCTGGGCAAGGGAGCTGG - Intronic
1181048916 22:20229559-20229581 GGGGGACTGGGCAGGGCTGCTGG - Intergenic
1181174073 22:21026190-21026212 TGGGGAGGTGGCAGGAGAGCAGG + Intronic
1181534651 22:23535066-23535088 CTGGGAGTGGGCAGGGGGGCTGG + Intergenic
1181590536 22:23882481-23882503 CGGGGACTTGGCAGGGGAGCTGG + Exonic
1181639286 22:24188338-24188360 CGGGGTCTTGGGAGAGGGGCTGG - Intronic
1181729027 22:24831313-24831335 CGGGGAGTTCCAAGGGGAGCTGG + Intronic
1181808161 22:25387684-25387706 CGGGGGCTTGGCAAGGCAGGAGG - Intronic
1182585455 22:31342089-31342111 TGGGAACTTGGCATGGGAGAGGG + Intronic
1182709162 22:32309972-32309994 GAGGGACTTGGCAGAGCAGCAGG + Intergenic
1183012765 22:34960802-34960824 TGGGGACTTGGAAGGGGACAGGG + Intergenic
1183467015 22:37984886-37984908 TGGGCACTTGGCAGGGGACTAGG + Intronic
1183584746 22:38746428-38746450 GGGGCAGGTGGCAGGGGAGCGGG + Intronic
1183702368 22:39457646-39457668 CGGGGAGTGGGCCGCGGAGCCGG - Intronic
1183776787 22:39971332-39971354 GGGGGAGTTGGGAGGGGGGCAGG + Exonic
1184034037 22:41910221-41910243 CGGGGACTGGGACGGGGACCGGG + Intronic
1184290877 22:43497599-43497621 CCAGGTCTTGGCTGGGGAGCAGG + Intronic
1184396771 22:44246938-44246960 GAGGGACTTGGCAGAGCAGCAGG + Exonic
1184518811 22:44980166-44980188 CTGGAACTTGGCAGGGGTGGTGG - Intronic
1184610865 22:45602279-45602301 TGGGGTCCTGGCAGGGAAGCAGG + Intergenic
1184663842 22:45977366-45977388 CGGGGACTGGGCGGGGGAAGAGG + Intergenic
1184767206 22:46577945-46577967 CCAGGACCTGGCAGGGGTGCAGG - Intronic
1185278007 22:49958012-49958034 TGGGGACTTGGCCGGGGGGTGGG + Intergenic
949877089 3:8633623-8633645 GGGGGCCTTGGCCGGGGGGCTGG - Intronic
949881435 3:8664057-8664079 AGAGGACTTGGCAGGGCACCTGG - Intronic
950036673 3:9890917-9890939 AGGGGACTTGGCAGGTGAGCGGG - Intronic
950170483 3:10835525-10835547 TGGGGACTTTCCAGAGGAGCAGG - Intronic
950678942 3:14571643-14571665 CCGTCACCTGGCAGGGGAGCTGG + Intergenic
950829539 3:15859988-15860010 GGGGGAGTCGGCAGGGGTGCGGG + Intergenic
950917873 3:16664053-16664075 CGGGGTGTGGGCAGGGGAGGAGG + Intronic
952155000 3:30633562-30633584 CAGGGGCCTGGCAGGGGAGTAGG + Intronic
952919823 3:38276705-38276727 CTGAGACTTGACAGGCGAGCAGG + Intronic
952942546 3:38454992-38455014 TGGGCACTTGGGAGGGGAGGGGG + Intronic
953069148 3:39502537-39502559 AGGGGACTTGGCACGGCGGCTGG - Exonic
953752220 3:45617566-45617588 CGGGCACTTTGCAGGGCTGCTGG - Intronic
954481128 3:50803123-50803145 CGGGGATTTGGCAGGGTCGTAGG + Intronic
955377854 3:58412913-58412935 CGGGGACGTGAGAGGTGAGCTGG - Exonic
956857729 3:73292400-73292422 GGGAGACTTGGCAGGCGATCAGG + Intergenic
959114981 3:102165740-102165762 CTAGGACTTGGCAGGGGTGGAGG + Intronic
959562913 3:107802874-107802896 CGGGGACTAGGGTGGGGAGAAGG - Intronic
959591926 3:108091067-108091089 CGGGGAGCAGGCGGGGGAGCGGG - Intergenic
959630910 3:108506316-108506338 GGTGGAATTGGCAGGGGGGCAGG + Intronic
959893249 3:111580103-111580125 CTGGGCCTTGGCAGGATAGCAGG - Intronic
960943048 3:122947018-122947040 CAGGGACATGGAAGGAGAGCTGG - Intronic
961059189 3:123813967-123813989 CTGGGACTATTCAGGGGAGCCGG + Intronic
961743380 3:129047348-129047370 CGGGGAGGTGGCAGTGGAGCAGG - Intergenic
963858254 3:150279225-150279247 CAGGGATGTGGCAGGGGAGGTGG - Intergenic
966147358 3:176826916-176826938 TGGGGACTTGGGAAGGGTGCGGG + Intergenic
966209886 3:177442515-177442537 CGGGGACATTGCCGGGGAGGAGG - Intergenic
966574452 3:181483953-181483975 GGGGGACTGGGAAGGGGAGGGGG - Intergenic
966886326 3:184379859-184379881 CTGGGACCGGGCAGGGGAGGAGG - Intronic
966988068 3:185200615-185200637 CAGTAATTTGGCAGGGGAGCAGG - Intronic
968447642 4:660371-660393 CTGAGGCTTGGCAGGGGATCTGG + Intronic
969098622 4:4752588-4752610 CGTGGCCGTGGCAGGGGAGTGGG - Intergenic
969099004 4:4755067-4755089 AGAGGACTTGGCGGGGGAGGAGG + Intergenic
969506845 4:7593498-7593520 AAGGGCCTTGGAAGGGGAGCAGG - Intronic
969536063 4:7756731-7756753 CGGGGACTGCGCCGAGGAGCCGG + Intergenic
970994621 4:22251206-22251228 CAGGGATTTTGAAGGGGAGCTGG - Intergenic
972670616 4:41211386-41211408 CGGGGGCGGGGGAGGGGAGCAGG - Intronic
972857340 4:43122345-43122367 AGGGGACTGGGCAGGGAAGGTGG + Intergenic
974227973 4:59072970-59072992 TAGGAACTTGGCAGTGGAGCAGG - Intergenic
976525773 4:86086003-86086025 CTGGGGCCTGTCAGGGGAGCTGG + Intronic
976743335 4:88379107-88379129 CGGGGAGCTGCCAGGTGAGCGGG + Exonic
980463970 4:133150786-133150808 GGGGGAGGTGGCGGGGGAGCAGG + Exonic
980554432 4:134384219-134384241 GAGGGAATGGGCAGGGGAGCAGG - Intergenic
981785793 4:148478402-148478424 GAGGGAGTTGGAAGGGGAGCAGG - Intergenic
981926966 4:150151043-150151065 CTGGGATGTGGCAGGAGAGCTGG - Intronic
985632458 5:1021289-1021311 GGGGGACCGGGCAGGGGAGCCGG - Intronic
985801436 5:2007508-2007530 CGGGGACTTGCCCCCGGAGCGGG - Intergenic
988430713 5:31115421-31115443 CTGGGGCCTGTCAGGGGAGCAGG + Intergenic
988560843 5:32279710-32279732 CACGGACCTGGCAGGGGGGCAGG + Intronic
991254495 5:64599410-64599432 GGAGGATTTGGCAGTGGAGCTGG + Intronic
991924368 5:71689890-71689912 CGGGGACTTGGGAGGAAAGAAGG + Intergenic
997115588 5:131122888-131122910 CGGGAACTTGGCAGGGGGAGGGG - Intergenic
997260897 5:132464899-132464921 GGTGGAGTTGGCAGGGGGGCTGG - Exonic
1001139138 5:169129034-169129056 CTTGGACACGGCAGGGGAGCGGG + Intronic
1001729639 5:173941909-173941931 TGGGGACTTGGCTGGGGATGAGG - Intronic
1002189833 5:177472721-177472743 CGGGGACTAGGCAGCTGGGCTGG - Intronic
1002597259 5:180332227-180332249 CGGGGAGGTGGCGGGGGGGCGGG + Intronic
1002775994 6:327796-327818 CAGGGACTTGGCAGGATGGCCGG + Intronic
1003175695 6:3751244-3751266 CGGGGACGCGGGAGGGGCGCGGG - Intronic
1005572374 6:27157700-27157722 CGGGGGCTTGGCATGGAATCTGG - Intergenic
1005782481 6:29207140-29207162 CAGGGACTAGGCAGTGGAGTTGG + Intergenic
1006166597 6:32069050-32069072 CGGGGAGTTGACAGTGGAGGAGG - Intronic
1006509677 6:34515183-34515205 CAGGGACCAGGCTGGGGAGCGGG + Intronic
1007589456 6:43012666-43012688 CGGGGATTGGGGAGGGGAGCTGG - Intronic
1007785670 6:44277914-44277936 AGGGGAGTTGGCAGGGCAGGAGG - Exonic
1009246057 6:61239053-61239075 TGAGGGCTTGGCAGGGGAGATGG + Intergenic
1010285202 6:74069139-74069161 GGGGCACTTGGCAGGGGTCCAGG + Intergenic
1013367042 6:109444369-109444391 AGGGAACTGGGCAGGGAAGCAGG + Intronic
1015577598 6:134689775-134689797 CTGGCACTTGGCAAAGGAGCTGG + Intergenic
1017115932 6:150976243-150976265 CTGGGAGCTGGGAGGGGAGCTGG + Intronic
1019437376 7:1028926-1028948 CAGGGCCTGGGCAGGGGAGATGG - Intronic
1019540015 7:1547225-1547247 AGGGGACTTGTCCGGGGAGCTGG - Intronic
1019607619 7:1918067-1918089 CGTGGACTGGGCAGAGGTGCTGG - Intronic
1019724776 7:2595484-2595506 CAGGGACCCGGCAGGTGAGCAGG + Intronic
1020438346 7:8189771-8189793 AGGGGGCTGGGCAGGGGGGCTGG + Intronic
1021628005 7:22614026-22614048 AGGGGAATGGGCAGGTGAGCAGG - Intronic
1021770112 7:23991265-23991287 GGGAGACTTGGAAGGGGAGAGGG + Intergenic
1022097281 7:27148728-27148750 CAGGCGCTAGGCAGGGGAGCAGG - Intronic
1022152109 7:27618531-27618553 CGGGGGCTGGGTAGGTGAGCAGG - Intronic
1023841406 7:44100634-44100656 CGGGGAGTGGGGAGGGGGGCAGG - Intergenic
1027217312 7:76192423-76192445 AGGGGCCTGGGCAGGGTAGCTGG + Intergenic
1027229081 7:76261721-76261743 CGGGGACAGGGCAGTGGAGAAGG + Intronic
1029146815 7:98452299-98452321 AGGTGACTTGGGATGGGAGCTGG + Intergenic
1029372489 7:100158421-100158443 CGCGGAGCTGGCAGGGGATCCGG - Exonic
1029676211 7:102070817-102070839 GGATGACCTGGCAGGGGAGCGGG - Intronic
1031557121 7:123191239-123191261 TGAGGTCTTGGCTGGGGAGCTGG + Intronic
1031624454 7:123976052-123976074 GGGGGACTTGGCAGTGCAGTCGG + Intergenic
1031991234 7:128200611-128200633 CGGGGAGTAGGCAGGTGATCAGG + Intergenic
1032787416 7:135211662-135211684 CGGGGCCTCGGGCGGGGAGCCGG - Intergenic
1034272050 7:149808108-149808130 CGTGAACTTCGCAGGGGACCTGG + Intergenic
1034458958 7:151187533-151187555 CGGGGACCTGGCAAGGTTGCAGG - Intronic
1035827639 8:2661420-2661442 AAGGCACTTGGCAGGGGAACTGG + Intergenic
1038064671 8:23951369-23951391 GGGAGACTTGGCAGGGAAGGTGG - Intergenic
1038661785 8:29503825-29503847 TTGTGACTTGGCAGGGCAGCAGG + Intergenic
1039840438 8:41289153-41289175 AGGGGCCTTGCCTGGGGAGCAGG + Intronic
1040785745 8:51160131-51160153 AGGGGATTTGGCAGGGGCACAGG - Intergenic
1042164355 8:65930991-65931013 CCGGGTCTTGGCTGGAGAGCAGG + Intergenic
1043205393 8:77432630-77432652 CAGGGATTTGGCAGGGGCACTGG - Intergenic
1047288493 8:123508442-123508464 GGGAGACTTCCCAGGGGAGCTGG - Intronic
1047413205 8:124641127-124641149 AGGGGACATGGCAGGGGACAAGG + Intronic
1047780386 8:128106299-128106321 CGCGGGCTGGGCAGGGGACCAGG + Intergenic
1048502403 8:134990360-134990382 CAGAGACTTGCAAGGGGAGCTGG - Intergenic
1049391491 8:142373817-142373839 AGGGAGCTAGGCAGGGGAGCGGG + Intronic
1049865803 8:144934651-144934673 CAGGGTCTTGGCAGGGGTGGAGG - Intronic
1050343289 9:4662367-4662389 CGGGGACTTGGCATCGCAGCTGG - Exonic
1051894181 9:21970995-21971017 CGTGGACCTGGCTGAGGAGCTGG - Exonic
1051897721 9:22006034-22006056 CGTGGACTTGGCCGAGGAGCGGG - Exonic
1052325104 9:27209143-27209165 CAGGGACTTTGCAGGAGAACTGG + Exonic
1053120820 9:35546575-35546597 CTGGGACTTGGCAGTGCACCAGG - Exonic
1054927083 9:70600430-70600452 CTGGGACTTGGAAGCTGAGCAGG + Intronic
1056706104 9:88953857-88953879 AGGGGCCTTGCCAGGGCAGCTGG + Intergenic
1056832717 9:89929803-89929825 CGGGGGCTGGGGAAGGGAGCAGG + Intergenic
1057074785 9:92132749-92132771 CTAGGGCTTGGCATGGGAGCAGG + Intergenic
1057429308 9:94979759-94979781 GGGGCAGGTGGCAGGGGAGCAGG + Intronic
1058910586 9:109516912-109516934 AGGGGACTTGCGAGGTGAGCAGG + Intergenic
1059633800 9:116153724-116153746 GGGGGACTTGGGGGGGGAGAAGG + Intergenic
1060168395 9:121440158-121440180 GGGAGAATTGACAGGGGAGCAGG - Intergenic
1060659681 9:125397376-125397398 GGTGGACGTGGCTGGGGAGCAGG + Intergenic
1061219507 9:129242095-129242117 AGGGGAGGTGGCAGAGGAGCAGG + Intergenic
1061389586 9:130310081-130310103 AGGGGAATGGGCAGGGGAGGGGG - Intronic
1061520981 9:131117692-131117714 CTGGGGCTTAGCAGGGAAGCTGG - Intronic
1061807646 9:133145342-133145364 CGGGGAGTTGCCAGGGGAAGGGG - Intronic
1062250020 9:135589208-135589230 CCAGGACCTGGCAGGAGAGCTGG - Intergenic
1062267477 9:135693910-135693932 CGGGGACAGGGCAGGGCAGACGG - Intronic
1062379640 9:136281056-136281078 GGGGGGCTTGGCAGGGCAGCTGG - Intergenic
1062426464 9:136508414-136508436 CGGGGAAATGGCCGGGGCGCGGG - Intronic
1062504464 9:136866039-136866061 CGGGGACAAGGCTGGGGTGCCGG - Intronic
1062539225 9:137034308-137034330 AGGGGGCTTGGGAGGGGGGCTGG + Intronic
1186368791 X:8925621-8925643 GGGGGACCAGGGAGGGGAGCCGG - Intergenic
1186463350 X:9765626-9765648 CGGGGACGTCGCGGGGGACCCGG + Exonic
1187089905 X:16085276-16085298 TGGGGACTAGACAGGGGAGGTGG + Intergenic
1190580348 X:51887639-51887661 CGGGGAGGGGGCAGGGGGGCGGG - Intronic
1190962530 X:55266875-55266897 TGGGTAAGTGGCAGGGGAGCAGG + Intronic
1192225794 X:69226910-69226932 GGAGGACCTGGCAGGGGAGGGGG + Intergenic
1194916420 X:99714746-99714768 ATGAGATTTGGCAGGGGAGCAGG - Intergenic
1196778733 X:119362967-119362989 GGGGGACTTGGCAGGGTCACAGG - Intergenic
1197749908 X:129957272-129957294 CGGGGCCTGGGCAGGGGCGGAGG - Intergenic
1198099970 X:133415050-133415072 CGGGGACTAGCGAGTGGAGCTGG + Exonic
1200141439 X:153904789-153904811 TGGGGACTGGGCAGGGGGGCAGG - Intronic